Saltar al contenido
Merck

EHU132681

MISSION® esiRNA

targeting human IFI16

Iniciar sesión para ver los precios por organización y contrato.

Seleccione un Tamaño

Cambiar Vistas

Acerca de este artículo

NACRES:
NA.51
UNSPSC Code:
41105324
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarle


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CAGCTCCACCCAACAGTTCTTCAACTGAGAACCCGAAAACAGTGGCCAAATGTCAGGTAACTCCCAGAAGAAATGTTCTCCAAAAACGCCCAGTGATAGTGAAGGTACTGAGTACAACAAAGCCATTTGAATATGAGACCCCAGAAATGGAGAAAAAAATAATGTTTCATGCTACAGTGGCTACACAGACACAGTTCTTCCATGTGAAGGTTTTAAACACCAGCTTGAAGGAGAAATTCAATGGAAAGAAAATCATCATCATATCAGATTATTTGGAATATGATAGTCTCCTAGAGGTCAATGAAGAATCTACTGTATCTGAAGCTGGTCCTAACCAAACGTTTGAGGTTCCAAATAAAATCATCAACAGAGCAAAGGAAACTCTGAAGATTGATATTCTTCACAAACAAGCTTCAGGA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... IFI16(3428)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Clase de almacenamiento

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos



Cindy Orvain et al.
The Journal of clinical investigation, 130(7), 3777-3790 (2020-04-03)
Hidradenitis suppurativa (HS) is a chronic, relapsing, inflammatory skin disease. HS appears to be a primary abnormality in the pilosebaceous-apocrine unit. In this work, we characterized hair follicle stem cells (HFSCs) isolated from HS patients and more precisely the outer
Stine Søby et al.
Herpesviridae, 3(1), 6-6 (2012-10-16)
Innate recognition is essential in the antiviral response against infection by herpes simplex virus (HSV). Chemokines are important for control of HSV via recruitment of natural killer cells, T lymphocytes, and antigen-presenting cells. We previously found that early HSV-1-mediated chemokine
A Berry et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 24(6), 1700-1713 (2010-01-21)
Previously, we used cDNA expression profiling to identify genes associated with glucocorticoid (Gc) sensitivity. We now identify which of these directly influence Gc action. Interferon-inducible protein 16 (IFI16), bone morphogenetic protein receptor type II (BMPRII), and regulator of G-protein signaling