Saltar al contenido
Merck

EHU143071

MISSION® esiRNA

targeting human BAG3

Iniciar sesión para ver los precios por organización y contrato.

Seleccione un Tamaño

Cambiar Vistas

Acerca de este artículo

NACRES:
NA.51
UNSPSC Code:
41105324
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarle


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCGCAAAGAGGTGGATTCTAAACCTGTTTCCCAGAAGCCCCCACCTCCCTCTGAGAAGGTAGAGGTGAAAGTTCCCCCTGCTCCAGTTCCTTGTCCTCCTCCCAGCCCTGGCCCTTCTGCTGTCCCCTCTTCCCCCAAGAGTGTGGCTACAGAAGAGAGGGCAGCCCCCAGCACTGCCCCTGCAGAAGCTACACCTCCAAAACCAGGAGAAGCCGAGGCTCCCCCAAAACATCCAGGAGTGCTGAAAGTGGAAGCCATCCTGGAGAAGGTACAGGGGCTGGAGCAGGCTGTAGACAACTTTGAAGGCAAGAAGACTGACAAAAAGTACCTGATGATCGAAGAGTATTTGACCAAAGAGCTGCTGGCCCTGGATTCAGTGGACCCCGAGGGACGAGCCGATGTGCGTCAGGCCAGGAGAGACGGTGTCAGGAAGGTTCAGACCATCTTGGAAAAACTTGAACAGAAAGCCATTGATGTCCCAGGTCAAGTCCAG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... BAG3(9531)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Clase de almacenamiento

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos



Fei Song et al.
Oncotarget, 8(56), 95392-95400 (2017-12-10)
Bcl2-associated athanogene 3 (BAG3) has been reported to be involved in aggressive progression of many tumors. In the present study, we examined the expression of BAG3 in human cervical cancer (CC) tissues and investigated the role of BAG3 in SiHa
Patrick Antonietti et al.
Molecular cancer therapeutics, 16(1), 156-168 (2016-10-26)
Malignant gliomas exhibit a high intrinsic resistance against stimuli triggering apoptotic cell death. HSF1 acts as transcription factor upstream of HSP70 and the HSP70 co-chaperone BAG3 that is overexpressed in glioblastoma. To specifically target this resistance mechanism, we applied the
Joseph M McClung et al.
Circulation, 136(3), 281-296 (2017-04-27)
Critical limb ischemia is a manifestation of peripheral artery disease that carries significant mortality and morbidity risk in humans, although its genetic determinants remain largely unknown. We previously discovered 2 overlapping quantitative trait loci in mice, We treated mice with