Saltar al contenido
Merck

EHU155611

MISSION® esiRNA

targeting human KDR

Iniciar sesión para ver los precios por organización y contrato.

Seleccione un Tamaño

Cambiar Vistas

Acerca de este artículo

NACRES:
NA.51
UNSPSC Code:
41105324
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarle


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGCGATGGCCTCTTCTGTAAGACACTCACAATTCCAAAAGTGATCGGAAATGACACTGGAGCCTACAAGTGCTTCTACCGGGAAACTGACTTGGCCTCGGTCATTTATGTCTATGTTCAAGATTACAGATCTCCATTTATTGCTTCTGTTAGTGACCAACATGGAGTCGTGTACATTACTGAGAACAAAAACAAAACTGTGGTGATTCCATGTCTCGGGTCCATTTCAAATCTCAACGTGTCACTTTGTGCAAGATACCCAGAAAAGAGATTTGTTCCTGATGGTAACAGAATTTCCTGGGACAGCAAGAAGGGCTTTACTATTCCCAGCTACATGATCAGCTATGCTGGCATGGTCTTCTGTGAAGCAAAAATTAATGATGAAAGTTACCAGTCTATTATGTACATAGTTGTCGTTGTAGGGTATAGGATTTATGATGTGGTTCTGAGTCCGTCTCATGGAA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... KDR(3791)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Clase de almacenamiento

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos



W-Z Hou et al.
European review for medical and pharmacological sciences, 21(5), 1080-1087 (2017-03-25)
Cerebral aneurysm is a common vascular disease with high morbidity and mortality. Vascular smooth muscle deletion or dysplasia is an important reason for the development of cerebral aneurysm. MiRNAs participate in a variety of biological functions through inhibiting target gene
Evan Bailey et al.
The American journal of pathology, 187(1), 25-32 (2016-11-16)
Vascular endothelial growth factor (VEGF)-D is capable of inducing angiogenesis and lymphangiogenesis through signaling via VEGF receptor (VEGFR)-2 and VEGFR-3, respectively. Mutations in the FIGF (c-fos-induced growth factor) gene encoding VEGF-D have not been reported previously. We describe a young
Lin-Bin Zhou et al.
International journal of ophthalmology, 13(7), 1039-1045 (2020-07-21)
To identify proangiogenic factors engaged in neovascular age-related macular degeneration (AMD) except vascular endothelial growth factor (VEGF) from human retinal pigment epithelial (hRPE) cells and investigate the underlying mechanisms. VEGF receptor 2 (VEGFR2) in ARPE-19 cells was depleted by siRNA