Iniciar sesión para ver los precios por organización y contrato.
Seleccione un Tamaño
Cambiar Vistas
Acerca de este artículo
NACRES:
NA.51
UNSPSC Code:
41105324
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarledescription
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GGCACACAGCTCGTAAGTCCTCCATCAAAGCTGCAGTTCCAGGAAACACTTCTACCCCCAGCTGCCAGAGCACCAACGGGCAGCCTCAGAGGGGAGCCTGTGGGAGATGGAGAGGTAGATCCCGTAGCCGGCGGGCGGCGACGTCCCGACCAGAGCGTGTGTGGCCCGATGGGGTCATCCCCTTTGTCATTGGGGGAAACTTCACTGGTAGCCAGAGGGCAGTCTTCCGGCAGGCCATGAGGCACTGGGAGAAGCACACCTGTGTCACCTTCCTGGAGCGCACTGACGAGGACAGCTATATTGTGTTCACCTATCGACCTTGCGGGTGCTGCTCCTACGTGGGTCGCCGCGGCGGGGGCCCCCAGGCCATCTCCATCGGCAAGAACTGTGACAAGTTCGGCATTGTG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... BMP1(649)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Clase de almacenamiento
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Elija entre una de las versiones más recientes:
¿Ya tiene este producto?
Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.
Thea Bismo Strøm et al.
Human molecular genetics, 29(8), 1229-1238 (2019-10-11)
The cell-surface low-density lipoprotein receptor (LDLR) internalizes low-density lipoprotein (LDL) by receptor-mediated endocytosis and plays a key role in the regulation of plasma cholesterol levels. The ligand-binding domain of the LDLR contains seven ligand-binding repeats of approximately 40 residues each.
Sreemoti Banerjee et al.
Scientific reports, 9(1), 11416-11416 (2019-08-08)
The development of cardiovascular disease is intimately linked to elevated levels of low-density lipoprotein (LDL) cholesterol in the blood. Hepatic LDL receptor (LDLR) levels regulate the amount of plasma LDL. We identified the secreted zinc metalloproteinase, bone morphogenetic protein 1