Iniciar sesión para ver los precios por organización y contrato.
Seleccione un Tamaño
Cambiar Vistas
Acerca de este artículo
NACRES:
NA.51
UNSPSC Code:
41105324
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarledescription
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CAGGTCACTAGGGGCTTCAGAAGAGCGCCTCTCTCCAGCCCTTGGCATCACCTGGGCTAACCAGCTCCTGATGCGACTGATGGTTGACCGCACCCATGAGGACGATGTTACCACAGGCTTGCCCAGAAGCCCAGTTCGGACTCTCCGAGTGCTCTTCGCCCCCCACCTACCCCTCTCCTCCTGCTGCTACACAGTCAGTGGGGAAGGCATTAGGGGGATGCCAGGAACACAGTCCTACTAACAGTGAGACCAGTGGGTCAGCCTGAGCAGGTCCCAAGGAACCCTGATTCTGATGACTCTTTCCAACAACCTGTCAGTCAGTGGCACCTGGTGAACAGGCACCCAGTGACGGTTAGTCTGTCAGTATCTGCTCTCTCCTCCCTGGGGTTCACCTACCCATTAGAGGATGACTGAGCAGCAGGAGCTCT
Ensembl | mouse accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
mouse ... XRCC3(74335), Xrcc3(74335)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Clase de almacenamiento
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Elija entre una de las versiones más recientes:
¿Ya tiene este producto?
Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.
Jo-Fan Chang et al.
Toxicological sciences : an official journal of the Society of Toxicology, 139(2), 396-406 (2014-03-29)
The nucleus is a key organelle in mammary cells, which is responsible for several cellular functions including cell proliferation, gene expression, and cell survival. In addition, the nucleus is the primary targets of doxorubicin treatment. In the current study, low-abundance
Marco Agostini et al.
Cancer biology & therapy, 16(8), 1160-1171 (2015-05-30)
Preoperative chemoradiotherapy is widely used to improve local control of disease, sphincter preservation and to improve survival in patients with locally advanced rectal cancer. Patients enrolled in the present study underwent preoperative chemoradiotherapy, followed by surgical excision. Response to chemoradiotherapy