Saltar al contenido
Merck

EMU052221

MISSION® esiRNA

targeting mouse Kdr

Iniciar sesión para ver los precios por organización y contrato.

Seleccione un Tamaño

Cambiar Vistas

Acerca de este artículo

NACRES:
NA.51
UNSPSC Code:
41105324
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarle


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CTCAATGTGGGGCTTGATTTCACCTGGCACTCTCCACCTTCAAAGTCTCATCATAAGAAGATTGTAAACCGGGATGTGAAACCCTTTCCTGGGACTGTGGCGAAGATGTTTTTGAGCACCTTGACAATAGAAAGTGTGACCAAGAGTGACCAAGGGGAATACACCTGTGTAGCGTCCAGTGGACGGATGATCAAGAGAAATAGAACATTTGTCCGAGTTCACACAAAGCCTTTTATTGCTTTCGGTAGTGGGATGAAATCTTTGGTGGAAGCCACAGTGGGCAGTCAAGTCCGAATCCCTGTGAAGTATCTCAGTTACCCAGCTCCTGATATCAAATGGTACAGAAATGGAAGGCCCATTGAGTCCAACTACACAATGATTGTTGGCGATGAACTCACCATCATGGAAGTGACTGAAAGAGATGCAGGAAACTACACGGTCATCCTCACCAA

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Clase de almacenamiento

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos



Ming-Heng Wu et al.
Angiogenesis, 17(4), 839-849 (2014-04-11)
Galectin-1 (Gal-1) is a β-galactoside-binding lectin that regulates endothelial cell migration, proliferation, and adhesion. However, the effect of Gal-1 on vascular permeability and the underlying mechanisms are unclear. We found that high Gal-1 expression was associated with elevated tumor vascular
Dongshi Chen et al.
Clinical cancer research : an official journal of the American Association for Cancer Research, 20(13), 3472-3484 (2014-04-26)
Regorafenib, a multikinase inhibitor targeting the Ras/Raf/MEK/ERK pathway, has recently been approved for the treatment of metastatic colorectal cancer. However, the mechanisms of action of regorafenib in colorectal cancer cells have been unclear. We investigated how regorafenib suppresses colorectal cancer
Richard P Hulse et al.
Clinical science (London, England : 1979), 129(8), 741-756 (2015-07-23)
Diabetic peripheral neuropathy affects up to half of diabetic patients. This neuronal damage leads to sensory disturbances, including allodynia and hyperalgesia. Many growth factors have been suggested as useful treatments for prevention of neurodegeneration, including the vascular endothelial growth factor