Saltar al contenido
Merck

EMU081361

MISSION® esiRNA

targeting mouse Ralbp1

Iniciar sesión para ver los precios por organización y contrato.

Seleccione un Tamaño

Cambiar Vistas

Acerca de este artículo

NACRES:
NA.51
UNSPSC Code:
41105324
Servicio técnico
¿Necesita ayuda? Nuestro equipo de científicos experimentados está aquí para ayudarle.
Permítanos ayudarle


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TTATGCCCCGATTTGAAGAGGCTTGTGGGAAGACCACAGAGATGGAGAAAGTGCAGGAATTCCAGCGCTTGCTCCGGGAACTGCCGGAGTGCAATCATCTTCTGCTTTCCTGGCTCATTGTGCACCTGGACCACGTCATTGCGAAGGAGCTGGAAACGAAGATGAACATCCAGAACATCTCTATAGTGCTGAGCCCCACCGTGCAGATCAGCAATCGGGTCCTGTACGTGCTTTTCACACATGTGCAAGAGCTCTTTGGCACCGTGGTCCTGAAGCAAGTAACAAGACCTCTGCGCTGGTCCAACATGGCCACGATGCCCACACTGCCAGAGACCCAAGCAGGCATCAAGGAGGAGATCAGGAGACAGGAGTTCCTTTTGAATTGTTTACATCGAGATCTGCAGGGCGGGATAAAGGACTTATCTAAAGAAGAAAGATTATGGGAAGTACAGAGGATTCTGACTGCCCTCAAG

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Clase de almacenamiento

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documentos section.

Si necesita más asistencia, póngase en contacto con Atención al cliente

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos



Yoshiko Kaku et al.
Cellular signalling, 27(9), 1713-1719 (2015-05-26)
The present study investigated 1,2-diarachidonoyl-sn-glycero-3-phosphoethanolamine (DAPE)-induced cell death in malignant pleural mesothelioma (MPM) cells. DAPE reduced cell viability in NCI-H28, NCI-H2052, NCI-H2452, and MSTO-211H MPM cell lines in a concentration (1-100μM)-dependent manner. In the flow cytometry using propidium iodide (PI)
W He et al.
Oncogene, 33(23), 3004-3013 (2013-07-09)
Killing cancer cells through the induction of apoptosis is one of the main mechanisms of chemotherapy. However, numerous cancer cells have primary or acquired apoptosis resistance, resulting in chemoresistance. In this study, using a novel chalcone derivative chalcone-24 (Chal-24), we
H Schoeneberger et al.
Oncogene, 34(31), 4032-4043 (2014-11-11)
Evasion of apoptosis in pediatric acute lymphoblastic leukemia (ALL) is linked to aberrant expression of inhibitor of apoptosis (IAP) proteins and dysregulated redox homeostasis, rendering leukemic cells vulnerable to redox-targeting therapies. Here we discover that inhibition of antioxidant defenses via