Skip to Content
Merck

EHU131661

MISSION® esiRNA

targeting human ABCB1

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCATGCTCAGACAGGATGTGAGTTGGTTTGATGACCCTAAAAACACCACTGGAGCATTGACTACCAGGCTCGCCAATGATGCTGCTCAAGTTAAAGGGGCTATAGGTTCCAGGCTTGCTGTAATTACCCAGAATATAGCAAATCTTGGGACAGGAATAATTATATCCTTCATCTATGGTTGGCAACTAACACTGTTACTCTTAGCAATTGTACCCATCATTGCAATAGCAGGAGTTGTTGAAATGAAAATGTTGTCTGGACAAGCACTGAAAGATAAGAAAGAACTAGAAGGTTCTGGGAAGATCGCTACTGAAGCAATAGAAAACTTCCGAACCGTTGTTTCTTTGACTCAGGAGCAGAAGTTTGAACATATGTATGCTCAGAGTTTGCAGGTACCATACAGAAACTCTTTGAGGAAAGCACACATCTTTGGAATTACATTTTCCTTCACCCAGGCAATGATGTA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... ABCB1(5243)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Ho Kyung Seo et al.
The Prostate, 80(6), 453-462 (2020-03-07)
Docetaxel is the preferred chemotherapeutic agent for hormone-refractory prostate cancer (PC) patients. However, patients eventually develop docetaxel resistance, and no effective treatment options are available for them. We aimed to establish docetaxel resistance in castration-resistant prostate cancer (CRPC) cell lines
Vlasta Němcová-Fürstová et al.
Toxicology and applied pharmacology, 310, 215-228 (2016-09-25)
Development of taxane resistance has become clinically very important issue. The molecular mechanisms underlying the resistance are still unclear. To address this issue, we established paclitaxel-resistant sublines of the SK-BR-3 and MCF-7 breast cancer cell lines that are capable of
Tao Wang et al.
Theranostics, 5(12), 1456-1472 (2015-12-19)
Understanding the molecular basis of drug resistance and utilising this information to overcome chemoresistance remains a key challenge in oncology. Here we report that survivin, a key protein implicated in drug resistance, is overexpressed in cancer stem cell pool of