Skip to Content
Merck

EHU043331

MISSION® esiRNA

targeting human SUZ12

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CAAGGCAACAAACTGAAGCAAGAGATGACCTGCATTGCCCTTGGTGTACTCTGAACTGCCGCAAACTTTATAGTTTACTCAAGCATCTTAAACTCTGCCATAGCAGATTTATCTTCAACTATGTTTATCATCCAAAAGGTGCTAGGATAGATGTTTCTATCAATGAGTGTTATGATGGCTCCTATGCAGGAAATCCTCAGGATATTCATCGCCAACCTGGATTTGCTTTTAGTCGCAACGGACCAGTTAAGAGAACACCTATCACACATATTCTTGTGTGCAGGCCAAAACGAACAAAAGCAAGCATGTCTGAATTTCTTGAATCTGAAGATGGGGAAGTAGAACAGCAAAGAACATATAGTAGTGGCCACAATCGTCTGTATTTCCATAGTGATACCTGCTTACCTCTCCGTCCACAAGAAATGGAAGTAGATAGTGAAGATGAAAAGGATCCTGAATGGC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... SUZ12(23512)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Young Hwa Soung et al.
Cancers, 12(8) (2020-08-14)
Triple-negative breast cancers (TNBCs) lack ER, PR and her2 receptors that are targets of common breast cancer therapies with poor prognosis due to their high rates of metastasis and chemoresistance. Based on our previous studies that epigenetic silencing of a
Xiaoli Wei et al.
Oncology letters, 18(2), 1607-1616 (2019-08-20)
Chemotherapy resistance is a major obstacle to the effective treatment of patients with gastric cancer (GC). Mounting evidence has indicated that the dysregulation of microRNAs (miRNAs) is associated with the sensitivity of cancer cells to chemotherapy. However, the mechanisms underlying
Lin Jin et al.
Cancer research, 77(20), 5464-5478 (2017-08-23)
NOTCH signaling exerts essential roles in normal and malignant intestinal physiology and the homeostasis of cancer stem-like cells (CSC), but the basis for this latter role remains obscure. The signaling scaffold protein STRAP is upregulated in several cancers, where it