Skip to Content
Merck

EHU062201

MISSION® esiRNA

targeting human EED

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGGAAGTCAAAGAAATGCAAATATTCTTTCAAATGTGTAAATAGTCTCAAGGAAGATCATAACCAACCATTGTTTGGAGTTCAGTTTAACTGGCACAGTAAAGAAGGAGATCCATTAGTGTTTGCAACTGTAGGAAGCAACAGAGTTACCTTGTATGAATGTCATTCACAAGGAGAAATCCGGTTGTTGCAATCTTACGTGGATGCTGATGCTGATGAAAACTTTTACACTTGTGCATGGACCTATGATAGCAATACGAGCCATCCTCTGCTGGCTGTAGCTGGATCTAGAGGCATAATTAGGATAATAAATCCTATAACAATGCAGTGTATAAAGCACTATGTTGGCCATGGAAATGCTATCAATGAGCTGAAATTCCATCCAAGAGATCCAAATCTTCTCCTGTCAGTAAGTAAAGATCATGCTTTACGATTATGGAATATCCAGACGGACACTCTGGTGGCAATATTTGGAGG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... EED(8726)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Bing He et al.
Oncotarget, 8(61), 103919-103930 (2017-12-22)
The miRNAs play important regulating roles in the pathogenesis of hepatocellular carcinoma (HCC). To uncover key regulating miRNAs in HCC that were neglected by traditional analyzing methods of transcriptomics data, we proposed a novel molecular-network-based omics' (MNBO) method. With this
Qipeng Liu et al.
International journal of cancer, 145(2), 415-426 (2019-01-11)
Polycomb group proteins are important epigenetic regulators for cell proliferation and differentiation, organ development, as well as initiation and progression of lethal diseases, including cancer. Upregulated Polycomb group proteins, including Enhancer of zeste homolog 2 (EZH2), promote proliferation, migration, invasion
Houliang Deng et al.
Scientific reports, 9(1), 197-197 (2019-01-19)
Chromobox 6 (CBX6) is a subunit of Polycomb Repressive Complex 1 (PRC1) that mediates epigenetic gene repression and acts as an oncogene or tumor suppressor in a cancer type-dependent manner. The specific function of CBX6 in breast cancer is currently