Skip to Content
Merck

EHU069501

MISSION® esiRNA

targeting human SMAD2 (2)

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATTGAGCCACAGAGTAATTATATTCCAGAAACGCCACCTCCTGGATATATCAGTGAAGATGGAGAAACAAGTGACCAACAGTTGAATCAAAGTATGGACACAGGCTCTCCAGCAGAACTATCTCCTACTACTCTTTCCCCTGTTAATCATAGCTTGGATTTACAGCCAGTTACTTACTCAGAACCTGCATTTTGGTGTTCGATAGCATATTATGAATTAAATCAGAGGGTTGGAGAAACCTTCCATGCATCACAGCCCTCACTCACTGTAGATGGCTTTACAGACCCATCAAATTCAGAGAGGTTCTGCTTAGGTTTACTCTCCAATGTTAACCGAAATGCCACGGTAGAAAT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... SMAD2(4087)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Ping Zhao et al.
Cancer chemotherapy and pharmacology, 84(2), 427-439 (2019-05-16)
Although DNA-mismatch-repair-deficient (dMMR) status and aberrant expression of miRNAs are both critically implicated in the pathogenesis of resistance to 5-fluorouracil (5-FU) in colorectal cancer (CRC), whether these two factors regulate tumor response to 5-FU in a coordinated manner remains unknown.
Wei Zhang et al.
Journal of Cancer, 12(6), 1678-1686 (2021-02-23)
Circular RNAs (circRNAs) are associated with various diseases, including cancers. However, their roles in colorectal cancer (CRC) have not been established. Hsa_circ_0000847 (circ_SMAD2) is a novel circRNA that was found to be elevated in CRC cell lines and tissues. High
Benjamin V Park et al.
Cancer discovery, 6(12), 1366-1381 (2016-09-30)
Programmed death-1 (PD-1) is a coinhibitory receptor that downregulates the activity of tumor-infiltrating lymphocytes (TIL) in cancer and of virus-specific T cells in chronic infection. The molecular mechanisms driving high PD-1 expression on TILs have not been fully investigated. We