Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GCCTCCTAGATGTAACATTCCTGATCAAGGTACAATTCTTTAAAATTCACTAATGATTGAGGTCCATATTTAGTGGTACTCTGAAATTGGTCACTTTCCTATTACACGGAGTGTGCTAAAACTAAAAAGCATTTTGAAACATACAGAATGTTCTATTGTCATTGGGAAATTTTTCTTTCTAACCCAGTGGAGGTTAGAAAGAAGTTATATTCTGGTAGCAAATTAACTTTACATCCTTTTTCCTACTTGTTATGGTTGTTTGGACCGATAAGTGTGCTTAATCCTGAGGCAAAGTAGTGAATATGTTTTATATGTTATGAAGAAAAGAATTGTTGTAAGTTTTTGATTCTACTCTTATATGCTGGACTGCATTCACACATGGCATGA
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... AKAP12(9590)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Takakuni Maki et al.
Stem cells (Dayton, Ohio), 36(5), 751-760 (2018-01-10)
Oligodendrocyte precursor cells (OPCs) give rise to oligodendrocytes in cerebral white matter. However, the underlying mechanisms that regulate this process remain to be fully defined, especially in adult brains. Recently, it has been suggested that signaling via A-kinase anchor protein
Hua Wei et al.
Neurochemical research, 44(4), 839-848 (2019-02-02)
Astrocytes migration is essential in the formation of the glial scar during the injury response process of the central nervous system (CNS) especially during inflammation. Integrin β1 is part of the extracellular matrix receptors in the CNS and it has
DHA Attenuates Hypoxia/Reoxygenation Injury by Activating SSeCKS in Human Cerebrovascular Pericytes.
Yanli Yu et al.
Neurochemical research, 45(2), 310-321 (2019-11-30)
Docosahexaenoic acid (DHA) can alleviate cerebral ischemia/reperfusion injury by reducing blood-brain barrier permeability and maintaining its integrity, accompanied by an increased Ang-1/Ang-2 ratio; however, the underlying mechanisms of these effects remain unclear. Src-suppressed C kinase substrates (SSeCKS), a substrate of