Skip to Content
Merck

EHU093621

MISSION® esiRNA

targeting human IQGAP3

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GAGGCGTCTGCACTACTTCCAGAAGAATGTTAACTCCATTGTGAAGATCCAGGCATTTTTCCGAGCCAGGAAAGCCCAAGATGACTACAGGATATTAGTGCATGCACCCCACCCTCCTCTCAGTGTGGTACGCAGATTTGCCCATCTCTTGAATCAAAGCCAGCAAGACTTCTTGGCTGAGGCAGAGCTGCTGAAGCTCCAGGAAGAGGTAGTTAGGAAGATCCGATCCAATCAGCAGCTGGAGCAGGACCTCAACATCATGGACATCAAGATTGGCCTGCTGGTGAAGAACCGGATCACTCTGCAGGAAGTGGTCTCCCACTGCAAGAAGCTGACCAAGAGGAATAAGGAACAGCTGTCAGATATGATGGTTCTGGACAAGCAGAAGGGTTTAAAGTCGCTGAGCAAAGAGAAACGGCAGAA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... IQGAP3(128239)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Yongjie Shi et al.
Journal of translational medicine, 15(1), 176-176 (2017-08-16)
Hepatocellular carcinoma (HCC) is one of the most lethal cancers worldwide owing to its high rates of metastasis and recurrence. The oncogene IQ motif-containing GTPase activating protein 3 (IQGAP3) is ubiquitously overexpressed in several human cancers, including liver, ovary, lung
Naohide Oue et al.
Pathobiology : journal of immunopathology, molecular and cellular biology, 85(3), 192-200 (2017-11-14)
Spheroid colony formation is a useful method of cancer stem cell (CSC) characterization. We previously showed that the IQ motif containing the GTPase-activating protein 3 gene (IQGAP3) is upregulated in spheroid body-forming gastric cancer (GC) cells compared with parental cells.
Chase J Morgan et al.
Scientific reports, 9(1), 11057-11057 (2019-08-01)
The Ras family of small GTPases modulates numerous essential processes. Activating Ras mutations result in hyper-activation of selected signaling cascades, which leads to human diseases. The high frequency of Ras mutations in human malignant neoplasms has led to Ras being