Skip to Content
Merck

EHU135861

MISSION® esiRNA

targeting human DSG3

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGGTGCAGACAAAGATGGAGAAGGACTATCAACTCAATGTGAATGTAATATTAAAGTGAAAGATGTCAACGATAACTTCCCAATGTTTAGAGACTCTCAGTATTCAGCACGTATTGAAGAAAATATTTTAAGTTCTGAATTACTTCGATTTCAAGTAACAGATTTGGATGAAGAGTACACAGATAATTGGCTTGCAGTATATTTCTTTACCTCTGGGAATGAAGGAAATTGGTTTGAAATACAAACTGATCCTAGAACTAATGAAGGCATCCTGAAAGTGGTGAAGGCTCTAGATTATGAACAACTACAAAGCGTGAAACTTAGTATTGCTGTCAAAAACAAAGCTGAATTTCACCAATCAGTTATCTCTCGATACCGAGTTCAGTCAACCCCAGTCACAATTCAGGTAATAAATGTAAGAGAAGGAATTGCATTCCGTCCTGCTTCCAAGACATTTACTGTGCAAAAAGGCATAAGTAGCAAAAAATTGGTGGATTATATCCTGGGAACATATCAAGCCATCGATGAGGACACTAACAAAGCTGCCTCAAATGTCA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... DSG3(1830)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Han Ri et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 118, 109214-109214 (2019-08-06)
To investigate the effects of desmoglein 3 (DSG3) gene mediating epidermal growth factor/epidermal growth factor receptor (EGF/EGFR) signaling pathway on inflammatory response and immune function of anaphylactic rhinitis (AR). Ten of the seventy male BALB/c mice were randomly selected as
Yuan Yan et al.
Theranostics, 10(22), 9970-9983 (2020-09-16)
Background: Induced pluripotent stem cells (iPSCs) have emerged as a promising treatment paradigm for skin wounds. Extracellular vesicles are now recognized as key mediators of beneficial stem cells paracrine effects. In this study, we investigated the effect of iPSCs-derived microvesicles
Jutamas Uttagomol et al.
International journal of molecular sciences, 20(24) (2019-12-15)
Desmoglein 3 (Dsg3) plays a crucial role in cell-cell adhesion and tissue integrity. Increasing evidence suggests that Dsg3 acts as a regulator of cellular mechanotransduction, but little is known about its direct role in mechanical force transmission. The present study