Skip to Content
Merck

EMU034161

MISSION® esiRNA

targeting mouse Bst2

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


Quality Level

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CAATCTACTTCGCCGTCACAGCGAACAGCGTGGCCTGTAGAGACGGGTTGCGAGCGCAGGCTGAGTGCCGGAACACCACGCACCTGTTGCAGCGCCAGCTCACCCGCACCCAGGACAGTCTGCTGCAGGCCGAGACACAGGCAAACTCCTGCAACCTGACCGTGGTGACCCTTCAGGAGTCCCTGGAGAAGAAGGTGTCTCAAGCCCTGGAGCAGCAGGCCCGCATCAAGGAGCTTGAGAATGAAGTCACGAAGCTGAACCAGGAGCTGGAGAATCTGAGGATCCAAAAGGAGACTTCTAGCACAGTGCAGGTGAACTCTGGCAGCTCCATGGTGGTCTCCAGCCTACTGGTGCTCAAAGTGTCACTGTTCCTGCTCTTTTGAGGACTCATTAGTTGGCAGGTCACAGTTGTTTGAAGTCACTATGGGTCATAGTGACTCTGGAGAGGTCCTGGCAGCCCTGAGGATGTGGAAACCACTAGGG

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Sebastian Giese et al.
PLoS pathogens, 10(7), e1004189-e1004189 (2014-07-06)
Bst-2/Tetherin inhibits the release of HIV by tethering newly formed virus particles to the plasma membrane of infected cells. Although the mechanisms of Tetherin-mediated restriction are increasingly well understood, the biological relevance of this restriction in the natural target cells
Kerstin Gnirß et al.
Journal of virology, 89(18), 9178-9188 (2015-06-26)
The expression of the antiviral host cell factor tetherin is induced by interferon and can inhibit the release of enveloped viruses from infected cells. The Vpu protein of HIV-1 antagonizes the antiviral activity of tetherin, and tetherin antagonists with Vpu-like
Jaraspim Narkpuk et al.
Biochemical and biophysical research communications, 450(4), 1469-1474 (2014-07-16)
While viral inhibition by tethering of budding virions to host cell membranes has been focused upon as one of the main functions of BST-2/tetherin, BST-2 is thought to possess other functions as well. Overexpression of BST-2 was found here to