Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
TCAAGGAGGCCTTCCTACAGGAAAATTTTGAATGACTTATCTTCTGATGCACCAGGGGTGCCAAGGATTGAAGAAGAAAAGTCAGAAGAGGAGACTTCAGCCCCTGCCATCACCACTGTAACAGTGCCAACCCCCATTTACCAAACTAGCAGTGGGCAGTACATTGCCATTACCCAGGGAGGAGCAATACAGCTGGCTAACAATGGTACGGATGGGGTACAGGGCCTGCAGACATTAACCATGACCAATGCAGCTGCCACTCAGCCGGGTACTACCATTCTACAGTATGCACAGACCACTGATGGACAGCAGATTCTAGTGCCCAGCAACCAAGTTGTTGTTCAAGCTGCCTCAGGCGATGTACAAACATACCAGATCCGCACAGCACCCACGAGCACCATTGCCCCTGGAGTTGTTA
Ensembl | mouse accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
mouse ... CREB1(12912), Creb1(12912)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Mutsumi Fujii et al.
Experimental neurology, 261, 396-403 (2014-07-25)
Early brain injury (EBI) which comprises of vasogenic edema and apoptotic cell death is an important component of subarachnoid hemorrhage (SAH) pathophysiology. This study evaluated whether cannabinoid receptor type 2 (CB2R) agonist, JWH133, attenuates EBI after SAH and whether CB2R
Jian Ye et al.
EMBO molecular medicine, 6(10), 1294-1311 (2014-09-19)
Accumulating evidence suggests the immunosuppressive microenvironments created by malignant tumors represent a major obstacle for effective anti-tumor immunity. A better understanding of the suppressive mechanisms mediated by tumor microenvironments and the development of strategies to reverse the immune suppression are
Wencheng Li et al.
American journal of physiology. Regulatory, integrative and comparative physiology, 309(2), R138-R147 (2015-05-23)
We reported that brain (pro)renin receptor (PRR) expression levels are elevated in DOCA-salt-induced hypertension; however, the underlying mechanism remained unknown. To address whether ANG II type 1 receptor (AT1R) signaling is involved in this regulation, we implanted a DOCA pellet