Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
AGCTAAGGCGGTGTGTGAATTTGAAGGCGGCCATCTCGCAACTTACAAGCAGCTAGAGGCAGCCAGAAAAATTGGATTTCATGTCTGTGCTGCTGGATGGATGGCTAAGGGCAGAGTTGGATACCCCATTGTGAAGCCAGGGCCCAACTGTGGATTTGGAAAAACTGGCATTATTGATTATGGAATCCGTCTCAATAGGAGTGAAAGATGGGATGCCTATTGCTACAACCCACACGCAAAGGAGTGTGGTGGCGTCTTTACAGATCCAAAGCAAATTTTTAAATCTCCAGGCTTCCCAAATGAGTACGAAGATAACCAAATCTGCTACTGGCACATTAGACTCAAGTATGGTCAGCGTATTCACCTGAGTTTTTTAGATTTTGACCTTGAAGATGACCCAGGTTGCTTG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... TNFAIP6(7130)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Guohu Di et al.
Investigative ophthalmology & visual science, 58(10), 4344–4354-4344–4354 (2017-08-16)
To explore the role and mechanism of bone marrow-derived mesenchymal stem cells (BM-MSCs) in corneal epithelial wound healing in type 1 diabetic mice. Diabetic mice were treated with subconjunctival injections of BM-MSCs or recombinant tumor necrosis factor-α-stimulated gene/protein-6 (TSG-6). The
Tae-Hoon Shin et al.
Cell death & disease, 7(12), e2524-e2524 (2016-12-23)
Rheumatoid arthritis (RA) is a long-lasting intractable autoimmune disorder, which has become a substantial public health problem. Despite widespread use of biologic drugs, there have been uncertainties in efficacy and long-term safety. Mesenchymal stem cells (MSCs) have been suggested as
Xifeng Li et al.
Journal of stroke and cerebrovascular diseases : the official journal of National Stroke Association, 29(12), 104986-104986 (2020-09-30)
Early brain injury (EBI) refers to acute brain injury during the first 72 h after subarachnoid hemorrhage (SAH), which is one of the major causes of poor prognosis after SAH. Here, we investigated the effect and the related mechanism of