Skip to Content
Merck

EMU050071

MISSION® esiRNA

targeting mouse Ptpn11

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGCTGGCTGAGACCACAGATAAAGTCAAGCAGGGCTTTTGGGAAGAGTTTGAGACGCTCCAGCAACAGGAATGCAAACTTCTCTATAGCCGAAAAGAAGGACAGAGACAAGAAAATAAAAACAAAAACAGATACAAAAACATCCTGCCCTTTGATCATACCAGGGTCGTTCTGCATGATGGGGATCCCAATGAGCCTGTTTCTGATTACATTAATGCAAACATCATCATGCCTGAGTTTGAGACCAAGTGCAACAATTCCAAACCCAAAAAGAGTTACATTGCCACTCAAGGCTGCCTGCAGAACACGGTGAATGACTTCTGGCGGATGGTGTTCCAGGAGAACTCTCGAGTCATTGTCATGACCACAAAGGAAGTGGAGAGAGGGAAGAGCAAATGTGTCAAGTACTGGCCTGATGAGTATGCGCTCAA

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Toru Mitsumori et al.
Experimental hematology, 42(9), 783-792 (2014-05-28)
The hypoxic microenvironment of the bone marrow, known as the hypoxic niche, supports hematopoietic stem cell quiescence and maintains long-term repopulation activity. Hypoxia also affects the expansion of progenitor cells and enhances erythropoiesis and megakaryopoiesis. In contrast to the known
Hsueh-Chun Wang et al.
BMC cancer, 14, 442-442 (2014-06-17)
Tumor invasion and metastasis represent a major unsolved problem in cancer pathogenesis. Recent studies have indicated the involvement of Src-homology 2 domain-containing tyrosine phosphatase 2 (SHP2) in multiple malignancies; however, the role of SHP2 in oral cancer progression has yet
Rong-Ping Zhou et al.
Molecular medicine reports, 11(6), 4489-4495 (2015-01-31)
Chlorogenic acid (CGA) exhibits various biological properties, including the inhibition of oxidation, obesity, apoptosis and tumorigenesis. CGA is also able to promote cell survival and proliferation. The aim of the present study was to determine the effects and underlying molecular