Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CCATCATGAGCAGAAGCAAACGTGACAACAATTTTTATAGTGTAGAGATTGGAGATTCTACATTCACAGTCCTAAAACGATACCAGAATTTAAAGCCTATAGGCTCAGGAGCTCAAGGAATAGTGTGTGCAGCTTATGATGCCATTCTTGAAAGAAATGTTGCAATCAAGAAGCTCAGCCGGCCATTTCAGAATCAGACCCATGCTAAGCGCGCCTACCGAGAACTAGTTCTTATGAAGTGTGTTAATCACAAAAATATAATTGGCCTTTTGAATGTTTTCACACCACAGAAATCCCTAGAAGAATTTCAAGATGTTTACATAGTCATGGAGCTCATGGATGCAAATCTTTGCCAAGTGATTCAGATGGAGTTAGATCATGAAAGAATGTCCTACCTTCTCTATCAAATGCTGTGTGGAATCAAGCACCTTCACTCTGCTG
Ensembl | mouse accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
mouse ... MAPK8(26419), Mapk8(26419)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
12 - Non Combustible Liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Xu Qin et al.
Molecular carcinogenesis, 53(7), 526-536 (2013-01-30)
The c-Jun NH2 -terminal kinase (JNK) signal pathway has been implicated in the growth, cellular proliferation, and apoptosis in many kinds of carcinomas. However, the role of JNK in the development of esophageal squamous cell carcinomas (ESCCs) is unknown. To
Shantel Olivares et al.
PloS one, 9(7), e103828-e103828 (2014-08-01)
Endoplasmic reticulum (ER) stress is induced in many forms of chronic liver disease and may promote the development of hepatocellular carcinoma. The activator protein 1 (AP-1) complex is a transcription factor that promotes hepatic carcinogenesis in response to cellular stress.
Wen-Tsong Hsieh et al.
Journal of neuro-oncology, 118(2), 257-269 (2014-04-24)
Glioblastoma multiforme (GBM) is the most common and lethal type of primary brain tumor characterized by its rapid infiltration to surrounding tissues during the early stages. The fast spreading of GBM obscures the initiation of the tumor mass making the