Skip to Content
Merck

EMU202811

MISSION® esiRNA

targeting mouse Ptprc

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TAAATACTATGAAGTGTCCCTACTTGCCTATGTCAATGGGAAGATTCAAAGAAATGGGACTGCTGAGAAGTGCAATTTTCACACAAAAGCAGATCGTCCGGACAAGGTCAATGGAATGAAAACCTCCCGGCCGACAGACAATAGTATAAATGTTACATGTGGTCCTCCTTATGAAACTAATGGCCCTAAAACCTTTTACATTTTGGTAGTCAGAAGTGGAGGTTCTTTTGTTACAAAATACAACAAGACAAACTGTCAGTTTTATGTAGATAATCTCTACTATTCAACTGACTATGAGTTTCTGGTCTCTTTTCACAATGGAGTGTACGAGGGAGATTCAGTTATAAGAAATGAGTCAACAAATTTTAATGCTAAAGCACTGATTATATTCCTGGTGTTTCTGATTATTGTGACATCAATAGCCTTGCTTGTTGTTTTGTATAAAATCTATGATCTGCGCAAGAAAAGATCCAGCAATTTAGATGAACAACAGGAACTCGTTGAAAGGGA

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Iwona Grabowska et al.
Journal of muscle research and cell motility, 36(6), 395-404 (2015-11-29)
The skeletal muscle injury triggers the inflammatory response which is crucial for damaged muscle fiber degradation and satellite cell activation. Immunodeficient mice are often used as a model to study the myogenic potential of transplanted human stem cells. Therefore, it
Asif Manzoor Khan et al.
Neurobiology of aging, 36(6), 2164-2175 (2015-04-22)
The susceptibility of the aging brain to neurodegenerative disease may in part be attributed to cellular aging of the microglial cells that survey it. We investigated the effect of cellular aging induced by telomere shortening on microglia by the use
Xu Chang Geng et al.
Molecular medicine reports, 11(5), 3860-3865 (2015-01-13)
Erythropoietin (EPO) is a hematopoietic hormone that protects against renal interstitial fibrosis in animal models; however, the mechanism underlying the anti‑fibrotic activity of EPO has remained elusive. The present study aimed to elucidate this mechanism. Twenty‑four male C57BL6 mice were