Skip to Content
Merck

EHU009241

MISSION® esiRNA

targeting human ITGB6 (2)

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CAAACTAGCAGGCATCGTCATTCCTAATGACGGGCTCTGTCACTTGGACAGCAAGAATGAATACTCCATGTCAACTGTCTTGGAATATCCAACAATTGGACAACTCATTGATAAACTGGTACAAAACAACGTGTTATTGATCTTCGCTGTAACCCAAGAACAAGTTCATTTATATGAGAATTACGCAAAACTTATTCCTGGAGCTACAGTAGGTCTACTTCAGAAGGACTCCGGAAACATTCTCCAGCTGATCATCTCAGCTTATGAAGAACTGCGGTCTGAGGTGGAACTGGAAGTATTAGGAGACACTGAAGGACTCAACTTGTCATTTACAGCCATCTGTAACAACGGTACCCTCTTCCAACACCAAAAGAAATGCTCTCACATGAAAGTGGGAGACACAGCTTCCTTCAGCGTGACTGTGAATATCCCACACTGCGAGAGAAGAAGCAGGCACATTATCATAAAGCCTGTGGGGCTGGGGGATGCCCTGGAATTACTTGTCAGCCCAGAATGCAACTGCGACTGTCAG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Gene Information

human ... ITGB6(3694)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Robert J Slack et al.
Pharmacology, 97(3-4), 114-125 (2016-01-07)
A20FMDV2 is a peptide derived from the foot-and-mouth disease virus with a high affinity and selectivity for the alpha-v beta-6 (αvβ6) arginyl-glycinyl-aspartic acid (RGD)-binding integrin. It has been shown to be an informative tool ligand in pre-clinical imaging studies for
Jiarui Bi et al.
Cytokine, 114, 135-142 (2018-11-24)
Epithelial αvβ6 integrin participates in immune surveillance in many organs, including the gastrointestinal track. Expression of αvβ6 integrin is reduced in the junctional epithelium of the gingiva in periodontal diseases, and mutations in the ITGB6 gene are associated with these
Jiarui Bi et al.
Scientific reports, 7(1), 4411-4411 (2017-07-02)
Periodontal diseases manifest by the formation of deep pockets between the gingiva and teeth where multispecies bacterial biofilms flourish, causing inflammation and bone loss. Epithelial cell receptor αvβ6 integrin that regulates inflammation by activating the anti-inflammatory cytokine transforming growth factor-β1
Runhong Han et al.
JCI insight, 4(7) (2019-04-05)
Chronic tubulointerstitial injury impacts the prognosis of focal segmental glomerulosclerosis (FSGS). We found that the level of versican V1 was increased in tubular cells of FSGS patients. Tubular cell-derived versican V1 induced proliferation and collagen synthesis by activating the CD44/Smad3

Related Content

Instructions

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service