Skip to Content
Merck

EHU009371

MISSION® esiRNA

targeting human CENPJ

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCTCGAAGATCCAAGTCTGCACCTCCTCGTGATTTAGGCAATTTGGATAAGGGACAAGCTGCCTCTCCCAGGGAGCCACTTGAACCACTGAACTTCCCAGATCCTGAATATAAAGAGGAGGAGGAAGACCAAGACATACAGGGAGAAATCAGTCATCCTGATGGAAAGGTGGAAAAGGTTTATAAGAATGGGTGCCGTGTTATACTGTTTCCCAATGGAACTCGAAAGGAAGTGAGTGCAGATGGGAAGACCATCACTGTCACTTTCTTTAATGGTGACGTGAAGCAGGTCATGCCAGACCAAAGAGTGATCTACTACTATGCAGCTGCCCAGACCACTCACACGACATACCCGGAGGGACTGGAAGTCTTACATTTCTCAAGTGGACAAATAGAAAAACATTACCCAGATGGAAGAAAAGAAATCACGTTTCCTGACCAGACTGTTAAAAACTTATTTCCTGATGGACAAGAAGAAAGCATTTTCCCAGATGGTACAATTGTCAGAGTACAACGTGATGGCAACAAACT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Gene Information

human ... CENPJ(55835)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Tao Xu et al.
Toxicology letters, 294, 177-183 (2018-05-21)
Alcohol can decrease cell proliferation in neural cells. The proliferation of neural cells can be inhibited by the asymmetric division of neural progenitor cells. However, whether alcohol inhibits cell proliferation through inducing cell asymmetric division is not yet clear. Here
Fernando R Balestra et al.
eLife, 10 (2021-01-26)
TRIM37 is an E3 ubiquitin ligase mutated in Mulibrey nanism, a disease with impaired organ growth and increased tumor formation. TRIM37 depletion from tissue culture cells results in supernumerary foci bearing the centriolar protein Centrin. Here, we characterize these centriolar
Patricia P Garcez et al.
Nature communications, 6, 6474-6474 (2015-03-11)
The proneural factor Ascl1 controls multiple steps of neurogenesis in the embryonic brain, including progenitor division and neuronal migration. Here we show that Cenpj, also known as CPAP, a microcephaly gene, is a transcriptional target of Ascl1 in the embryonic

Related Content

Instructions

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service