Skip to Content
Merck

EHU037061

MISSION® esiRNA

targeting human SALL4

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

Product Name

MISSION® esiRNA, targeting human SALL4

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TCCAGAAAGTGAGGGTGGACCCACACTCCCTGGGGTGGGACCAAACTATAATTCCCCAAGGGCTGGTGGCTTCCAAGGGAGTGGGACCCCTGAGCCAGGGTCAGAGACCCTGAAATTGCAGCAGTTGGTGGAGAACATTGACAAGGCCACCACTGATCCCAACGAATGTCTCATTTGCCACCGAGTCTTAAGCTGTCAGAGCTCCCTCAAGATGCATTATCGCACCCACACCGGGGAGAGACCGTTCCAGTGTAAGATCTGTGGCCGAGCCTTTTCTACCAAAGGTAACCTGAAGACACACCTTGGGGTTCACCGAACCAACACATCCATTAAGACGCAGCATTCGTGCCCCATCTGCCAGAAGAAGTTCACTAATGCCGTGATGCTGCAGCAACATATTCGGATGCACA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Dengfeng Zhang et al.
Oncology research, 25(5), 763-771 (2016-12-17)
Sal-like protein 4 (SALL4) is a zinc finger transcription factor that has been reported to be aberrantly expressed in several human malignancies and identified as an oncogene. However, the potential role of SALL4 in osteosarcoma remains to be elucidated. In
AmirReza Hesari et al.
Journal of cellular biochemistry (2019-02-17)
Colorectal cancer (CRC) is known as the third most common malignancies among men and women and is also the second leading cause of cancer-related deaths worldwide. It has been indicated that a variety of risk factors are involved in the
Kol Jia Yong et al.
Oncotarget, 7(46), 75425-75440 (2016-10-06)
The overall survival of lung cancer patients remains dismal despite the availability of targeted therapies. Oncofetal protein SALL4 is a novel cancer target. We herein report that SALL4 was aberrantly expressed in a subset of lung cancer patients with poor
Amireza Hesari et al.
Journal of cellular biochemistry, 120(6), 9392-9399 (2018-12-07)
Breast cancer is the most prevalent cancers worldwide and causes a significant amount of deaths annually. Spalt-like transcription factor 4 is known as a transcription factor, which has an important role in the proliferation of cancerous cells. Small interfering RNA
Mei Wang et al.
Journal of cellular biochemistry, 120(9), 15027-15037 (2019-04-23)
MicroRNAs (miRNAs) play pivotal roles in modulating key biological processes in gastric cancer (GC). As a newly identified miRNA, the function and potential mechanism of miR-188-5p in GC has not been thoroughly elucidated. Here, quantitative real-time polymerase chain reaction detection

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service