Skip to Content
Merck

EHU049051

MISSION® esiRNA

targeting human XRN2

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGATGCTAGTGCTCCTGGTGAAGGAGAACATAAAATCATGGATTACATTAGAAGGCAAAGAGCCCAGCCTAACCATGACCCAAATACTCATCATTGTTTATGTGGAGCAGATGCTGATCTCATTATGCTTGGCCTTGCCACACATGAACCGAACTTTACCATTATTAGAGAAGAATTCAAACCAAACAAGCCCAAACCATGTGGTCTTTGTAATCAGTTTGGACATGAGGTCAAAGATTGTGAAGGTTTGCCAAGAGAAAAGAAGGGAAAGCATGATGAACTTGCCGATAGTCTTCCTTGTGCAGAAGGAGAGTTTATCTTCCTTCGGCTTAATGTTCTTCGTGAGTATTTGGAAAGAGAACTCACAATGGCCAGCCTACCATTCACATTTGATGTTGAGAGGAGCATTGATGACTGGGTTTTCATGTGCTTCTTTGTGGGAAATGACTTCCTCC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... XRN2(22803)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Praveen L Patidar et al.
Scientific reports, 10(1), 14253-14253 (2020-08-30)
Persistent R-loops (RNA-DNA hybrids with a displaced single-stranded DNA) create DNA damage and lead to genomic instability. The 5'-3'-exoribonuclease 2 (XRN2) degrades RNA to resolve R-loops and promotes transcription termination. Previously, XRN2 was implicated in DNA double strand break (DSB)
Rodney P Kincaid et al.
Proceedings of the National Academy of Sciences of the United States of America, 115(32), 8197-8202 (2018-07-25)
Seventy percent of people infected with hepatitis C virus (HCV) will suffer chronic infection, putting them at risk for liver disease, including hepatocellular carcinoma. The full range of mechanisms that render some people more susceptible to chronic infection and liver
Jong-Sun Lee et al.
Molecular cell, 77(5), 1044-1054 (2020-01-12)
Antisense oligonucleotides (ASOs) that trigger RNase-H-mediated cleavage are commonly used to knock down transcripts for experimental or therapeutic purposes. In particular, ASOs are frequently used to functionally interrogate long noncoding RNAs (lncRNAs) and discriminate lncRNA loci that produce functional RNAs