Skip to Content
Merck

EHU123581

MISSION® esiRNA

targeting human THPO

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TCTCAGACACTGCCGACATCAGCATTGTCTCGTGTACAGCTCCCTTCCCTGCAGGGCGCCCCTGGGAGACAACTGGACAAGATTTCCTACTTTCTCCTGAAACCCAAAGCCCTGGTAAAAGGGATACACAGGACTGAAAAGGGAATCATTTTTCACTGTACATTATAAACCTTCAGAAGCTATTTTTTTAAGCTATCAGCAATACTCATCAGAGCAGCTAGCTCTTTGGTCTATTTTCTGCAGAAATTTGCAACTCACTGATTCTCTACATGCTCTTTTTCTGTGATAACTCTGCAAAGGCCTGGGCTGGCCTGGCAGTTGAACAGAGGGAGAGACTAACCTTGAGTCAGAAAACAGAGAAAGGGTAATTTCCTTTGCTTCAAATTCAAGGCCTTCCAACGCCCCCATCCCCTTTACTATCATTCTCAGTGGGACTCTGATCCC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... THPO(7066)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Ting Zou et al.
Cancer biomarkers : section A of Disease markers, 25(2), 133-139 (2018-11-20)
Long noncoding RNAs (LncRNAs) are involved in the occurrence and progression of human tumors including ovarian cancer (OC). Long noncoding RNA HOTTIP has been found to be involved in several human tumors development. However, the role of HOTTIP in OC
Bo-Wen Dai et al.
Journal of Cancer, 10(19), 4540-4551 (2019-09-19)
As a master regulator of embryonic morphogenesis, homeodomain-containing gene 10 (HOXC10) has been found to promote progression of human cancers and indicate poor survival outcome. Therefore, we concentrate on elucidating the role of HOXC10 in progression of oral squamous cell
Bo Li et al.
Free radical research, 52(4), 390-401 (2018-02-06)
Substantial evidence indicates that the alteration of the cellular redox status is a critical factor involved in cell growth and death and results in tumourigenesis. Cancer cells have an efficient antioxidant system to counteract the increased generation of ROS. However