Skip to Content
Merck

EHU125631

MISSION® esiRNA

targeting human FGFR2

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCCAACACTGTCAAGTTTCGCTGCCCAGCCGGGGGGAACCCAATGCCAACCATGCGGTGGCTGAAAAACGGGAAGGAGTTTAAGCAGGAGCATCGCATTGGAGGCTACAAGGTACGAAACCAGCACTGGAGCCTCATTATGGAAAGTGTGGTCCCATCTGACAAGGGAAATTATACCTGTGTAGTGGAGAATGAATACGGGTCCATCAATCACACGTACCACCTGGATGTTGTGGAGCGATCGCCTCACCGGCCCATCCTCCAAGCCGGACTGCCGGCAAATGCCTCCACAGTGGTCGGAGGAGACGTAGA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Jian Chen et al.
Cell death & disease, 8(10), e3090-e3090 (2017-10-06)
Therapeutics used to treat central nervous system (CNS) injury were designed to repair neurites and inhibit cell apoptosis. Previous studies have shown that neuron-derived FGF10 exerts potential neuroprotective effects after cerebral ischemia injury. However, little is known about the role
Sergei Boichuk et al.
Anti-cancer drugs, 29(6), 549-559 (2018-04-27)
The acquired resistance of gastrointestinal stromal tumors (GISTs) to the targeted-based therapy remains the driving force to identify the novel approaches that are capable of increasing the sensitivity of GISTs to the current therapeutic regimens. Our present data show that
Yu Sun et al.
Experimental and therapeutic medicine, 18(2), 1440-1448 (2019-07-19)
MicroRNAs (miRNAs) are frequently dysregulated in cervical cancer, and the aberrant regulation of miRNAs may be involved in the regulation of various cancer-associated biological processes. Therefore, further exploration of the specific roles of dysregulated miRNAs in cervical cancer and their
Maud Toulmonde et al.
EBioMedicine, 62, 103131-103131 (2020-12-01)
Undifferentiated pleomorphic sarcoma (UPS) is the most frequent, aggressive and less-characterized sarcoma subtype. This study aims to assess UPS molecular characteristics and identify specific therapeutic targets. High-throughput technologies encompassing immunohistochemistry, RNA-sequencing, whole exome-sequencing, mass spectrometry, as well as radiomics were
Jan Rossaint et al.
The Journal of clinical investigation, 126(3), 962-974 (2016-02-16)
Chronic kidney disease (CKD) has been associated with impaired host response and increased susceptibility to infections. Leukocyte recruitment during inflammation must be tightly regulated to protect the host against pathogens. FGF23 levels are increased in blood during CKD, and levels

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service