Skip to Content
Merck

EHU135281

MISSION® esiRNA

targeting human BCL2

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CGGCCTCTGTTTGATTTCTCCTGGCTGTCTCTGAAGACTCTGCTCAGTTTGGCCCTGGTGGGAGCTTGCATCACCCTGGGTGCCTATCTGGGCCACAAGTGAAGTCAACATGCCTGCCCCAAACAAATATGCAAAAGGTTCACTAAAGCAGTAGAAATAATATGCATTGTCAGTGATGTACCATGAAACAAAGCTGCAGGCTGTTTAAGAAAAAATAACACACATATAAACATCACACACACAGACAGACACACACACACACAACAATTAACAGTCTTCAGGCAAAACGTCGAATCAGCTATTTACTGCCAAAGGGAAATATCATTTATTTTTTACATTATTAAGAAAAAAAGATTTATTTATTTAAGACAGTCCCATCAAAACTCCTGTCTTTGGAAATCCGACCACTAATTGCCAAGCACC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Donghai Zhuang et al.
Oncology research, 28(4), 399-408 (2020-04-11)
miRNAs play an important role in progression of hepatocellular carcinoma (HCC). In this work, we assessed the function of miR-202 in human HCC and identified BCL2 as its target. We found miR-202 expression was found significantly downregulated, while BCL2 expression
Tian-Quan Yang et al.
OncoTargets and therapy, 10, 4305-4313 (2017-09-19)
Glioma is one of the most common types of adult primary brain tumors, and the underlying molecular mechanisms still remain unclear. Nuclear factor-kappa B1 (NF-κB1) is involved in a variety of malignancies and is widely expressed in malignant tumors. However
Ya'nan Yang et al.
OncoTargets and therapy, 12, 897-906 (2019-02-19)
Peritoneal metastasis is the most common pathway for the spread of ovarian cancer. Ovarian cancer cells in ascites prefer to aggregate into the more chemoresistant multicellular spheroids (MCSs), leading to treatment failure and disease recurrence. We previously established a suspension
Jianxu Zhang et al.
International journal of nanomedicine, 12, 4721-4732 (2017-07-26)
Herein, DNA duplex was constructed through the hybridization of adenosine triphosphate (ATP)-responsive aptamer and its cDNA in which GC-rich motif could be used to load doxorubicin (DOX), and then, cationic polymer PEI25K was used as a carrier to simultaneously condense
Qi Xie et al.
International journal of oncology, 49(6), 2507-2519 (2016-10-18)
Bcl-2, which belongs to the Bcl-2 family, is frequently overexpressed in various types of cancer cells and contributes to drug resistance. However, the function of Bcl-2 in cisplatin resistance in human ovarian cancer cells is not fully understood. In this

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service