Skip to Content
Merck

EHU144451

MISSION® esiRNA

targeting human NUPR1

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GAAGAGAGGCAGGGAAGACAAGCCAGGCACGATGGCCACCTTCCCACCAGCAACCAGCGCCCCCCAGCAGCCCCCAGGCCCGGAGGACGAGGACTCCAGCCTGGATGAATCTGACCTCTATAGCCTGGCCCATTCCTACCTCGGAGGTGGAGGCCGGAAAGGTCGCACCAAGAGAGAAGCTGCTGCCAACACCAACCGCCCCAGCCCTGGCGGGCACGAGAGGAAACTGGTGACCAAGCTGCAGAATTCAGAGAGGAAGAAGCGAGGGGCACGGCGCTGAGACAGAGCTGGAGATGAGGCCAGACCATGGACACTACACCCAGCAATAGAGACGGGACTGCGGAGGAAGGAGGACCCAGGACAGGATCCAGGCCGGCTTGCCACACCCCCCACCCCTAGGACTTATTCCCGCTGACTGAGTCTCTGAGGGGCTACCAGGAAAGCGCCTCCAACCCTAGCAAAAGTGCAAGATGGGGAGTG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... NUPR1(26471)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Patricia M Schnepp et al.
Molecular cancer research : MCR, 18(9), 1290-1301 (2020-06-10)
The majority of patients with prostate cancer treated with docetaxel develop resistance to it. To better understand the mechanism behind the acquisition of resistance, we conducted single-cell RNA-sequencing (scRNA-seq) of docetaxel-sensitive and -resistant variants of DU145 and PC3 prostate cancer
Ki-Sun Kim et al.
Anatomy & cell biology, 45(1), 17-25 (2012-04-27)
Nuclear protein-1 (NUPR1) is a small nuclear protein that is responsive to various stress stimuli. Although NUPR1 has been associated with cancer development, its expression and roles in cholangiocarcinoma have not yet been described. In the present study, we found
Anthony Murphy et al.
Oncology reports, 45(4) (2021-03-03)
Nickel (Ni) is carcinogenic to humans, and causes cancers of the lung, nasal cavity, and paranasal sinuses. The primary mechanisms of Ni‑mediated carcinogenesis involve the epigenetic reprogramming of cells and the ability for Ni to mimic hypoxia. However, the exact