Skip to Content
Merck

EHU145981

MISSION® esiRNA

targeting human BCL11A

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCCTTCAGGACTAGGTGCAGAATGTCCTTCCCAGCCACCTCTCCATGGGATTCATATTGCAGACAATAACCCCTTTAACCTGCTAAGAATACCAGGATCAGTATCGAGAGAGGCTTCCGGCCTGGCAGAAGGGCGCTTTCCACCCACTCCCCCCCTGTTTAGTCCACCACCGAGACATCACTTGGACCCCCACCGCATAGAGCGCCTGGGGGCGGAAGAGATGGCCCTGGCCACCCATCACCCGAGTGCCTTTGACAGGGTGCTGCGGTTGAATCCAATGGCTATGGAGCCTCCCGCCATGGATTTCTCTAGGAGACTTAGAGAGCTGGCAGGGAACACGTCTAGCCCACCGCTGTCCCCAGGCCGGCCCAGCCCTATGCAAAGGTTACTGCAACCATTCCAGCCAGGTAGCAAGCCGCCCTTCCTGGCGACGCCCCCCCTCCCTCCTCTGCAATCCGCCCCTCCTCCCTCCCAGCCCCCGGTCAAGTCCAAGTCATGCGAGTTCTG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... BCL11A(53335)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Chen-Han Zhang et al.
Oncotarget, 8(51), 88658-88669 (2017-11-29)
Tamoxifen resistance is a serious problem in the endocrine therapy of breast cancer. Long non-coding RNAs play important roles in tumor development. In this study, we revealed the involvement of lncRNA uc.57 and its downstream gene BCL11A in TAM resistance.
Alberto Daniel-Moreno et al.
Blood cells, molecules & diseases, 84, 102456-102456 (2020-06-05)
β-Hemoglobinopathies are among the most common single-gene disorders and are caused by different mutations in the β-globin gene. Recent curative therapeutic approaches for these disorders utilize lentiviral vectors (LVs) to introduce a functional copy of the β-globin gene into the
Samarwadee Plianwong et al.
Pharmaceutical research, 37(3), 46-46 (2020-02-06)
Short interfering RNA (siRNA) therapy promises a new era in treatment of breast cancers but effective delivery systems are needed for clinical use. Since silencing complementary targets may offer improved efficacy, this study was undertaken to identify non-viral carriers for