Skip to Content
Merck

EMU088711

MISSION® esiRNA

targeting mouse Atp11c

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TTGAAAATGCAAAGCGAGTGAGGAAAGAAAGTGAAAAAATCAAGGTTGGTGATGTAGTAGAAGTACAGGCAAATGAAACCTTTCCCTGTGATCTTATACTTCTGTCATCCTGCACAACTGATGGAACCTGTTATGTCACTACAGCCAGTCTTGATGGTGAATCTAATTGCAAGACACATTATGCAGTACGAGATACCATTGCACTGTGTACAGCCGAATCCATTGATAATCTCCGAGCAACAATTGAATGTGAGCAGCCTCAACCTGATCTCTACAGGTTTGTTGGGCGAATCAGTATCTATAGTAATAGTATTGAGGCTGTTGCCAGGTCTTTGGGACCTGAAAATCTTTTGCTGAAAGGAGCCACACTTAAAAATACCAAGAAGATATATGGAGTTGCTGTTTACACTGGGATGGAAACCAAAATGGCTTTGAACTACCAAGGGAAATCTCAGAAATGTTCTGCTGTTGAAAAATCTATTAATGCCTTCTTGATTGTTTATTTATTTATCTTACTGACCAAAGCTGCAGTATGCA

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Taryn E Travis et al.
Journal of burn care & research : official publication of the American Burn Association, 36(3), e125-e135 (2014-07-23)
The duroc pig has been described as a promising animal model for use in the study of human wound healing and scar formation. However, little is known about the presence and chronology of the fibrocyte cell population in the healing
Paweł Jóźwiak et al.
Nutrition and cancer, 67(8), 1333-1341 (2015-09-19)
Enhanced glucose requirement of cancer cells is associated with an increased glucose transport across plasma membrane that is mediated by a family of facilitated glucose transporter proteins, named GLUTs. GLUT1 is the main transporter in thyroid cancer cells. Glucose is
Chong-Shan Shi et al.
Journal of immunology (Baltimore, Md. : 1950), 193(6), 3080-3089 (2014-08-20)
Coronaviruses (CoV) have recently emerged as potentially serious pathogens that can cause significant human morbidity and death. The severe acute respiratory syndrome (SARS)-CoV was identified as the etiologic agent of the 2002-2003 international SARS outbreak. Yet, how SARS evades innate