Skip to Content
Merck

EHU030001

MISSION® esiRNA

targeting human DAB1

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TCGGGATTGATGAAGTTTCCGCAGCTCGGGGAGACAAGTTATGTCAAGATTCCATGATGAAACTCAAGGGCGTTGTTGCTGGCGCTCGTTCCAAAGGAGAACACAAACAGAAAATCTTTTTAACCATCTCCTTTGGAGGAATCAAAATCTTTGATGAGAAGACAGGGGCCCTTCAGCATCATCATGCTGTTCATGAAATATCCTACATTGCAAAGGACATTACAGATCACCGGGCCTTTGGATATGTTTGTGGGAAGGAAGGGAATCACAGATTTGTGGCCATAAAAACAGCCCAGGCGGCTGAACCTGTTATTCTGGACTTGAGAGATCTCTTTCAACTCATTTATGAATTGAAGCAAAGAGAAGAATTAGAAAAAAAGGCACAAAAGGATAAGCAGTGTGAACAAGCTGTGTACCAGACAATATTGGAAGAGGATGTTGAAGATCCTGTGTACCAGTACATTGTGTTTGAGGCTGGACAC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Isabelle Tancioni et al.
Molecular cancer therapeutics, 13(8), 2050-2061 (2014-06-06)
Ovarian cancer ascites fluid contains matrix proteins that can impact tumor growth via integrin receptor binding. In human ovarian tumor tissue arrays, we find that activation of the cytoplasmic focal adhesion (FAK) tyrosine kinase parallels increased tumor stage, β5 integrin
Bon-Hyeock Koo et al.
Experimental & molecular medicine, 51(6), 60-60 (2019-06-04)
Although arginase II (ArgII) is abundant in mitochondria, Ca2+-accumulating organelles, the relationship between ArgII activity and Ca2+ translocation into mitochondria and the regulation of cytosolic Ca2+ signaling are completely unknown. We investigated the effects of ArgII activity on mitochondrial Ca2+
Julia Lindqvist et al.
Molecular biology of the cell, 26(11), 1971-1984 (2015-04-09)
Contrary to cell cycle-associated cyclin-dependent kinases, CDK5 is best known for its regulation of signaling processes in differentiated cells and its destructive activation in Alzheimer's disease. Recently, CDK5 has been implicated in a number of different cancers, but how it

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service