Skip to Content
Merck

EHU050101

MISSION® esiRNA

targeting human PARP1

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CACTCATGCAACCACACACAATGCGTATGACTTGGAAGTCATCGATATCTTTAAGATAGAGCGTGAAGGCGAATGCCAGCGTTACAAGCCCTTTAAGCAGCTTCATAACCGAAGATTGCTGTGGCACGGGTCCAGGACCACCAACTTTGCTGGGATCCTGTCCCAGGGTCTTCGGATAGCCCCGCCTGAAGCGCCCGTGACAGGCTACATGTTTGGTAAAGGGATCTATTTCGCTGACATGGTCTCCAAGAGTGCCAACTACTGCCATACGTCTCAGGGAGACCCAATAGGCTTAATCCTGTTGGGAGAAGTTGCCCTTGGAAACATGTATGAACTGAAGCACGCTTCACATATCAGCAAGTTACCCAAGGGCAAGCACAGTGTCAAAGGTTTGGGCAAAAC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Zhuoyu Gu et al.
Journal of hematology & oncology, 11(1), 115-115 (2018-09-16)
Recently, many potential prognostic biomarkers for gastric cancer (GC) have been identified, but the prognosis of advanced GC patients remains poor. Chloride channels are promising cancer biomarkers, and their family member chloride channel-3 (CLC-3) is involved in multiple biological behaviors.
Jian-Ning Zhang et al.
Mediators of inflammation, 2019, 3013716-3013716 (2020-02-23)
Sepsis is a leading cause of death in patients with severe infection worldwide. Remifentanil is an ultra-short-acting, potent opioid analgesic. In the study, we aimed to investigate the role and underlying mechanism of remifentanil in lipopolysaccharide- (LPS-) induced inflammation in
Monica E Wielgos et al.
Molecular cancer therapeutics, 17(5), 921-930 (2018-03-30)
HER2-targeted therapies, such as trastuzumab, have increased the survival rates of HER2+ breast cancer patients. However, despite these therapies, many tumors eventually develop resistance to these therapies. Our lab previously reported an unexpected sensitivity of HER2+ breast cancer cells to
Manish Mishra et al.
Biochimica et biophysica acta, 1863(7), 1761-1769 (2017-05-10)
In diabetes, matrix metalloproteinase-9 (MMP-9) is activated, which damages mitochondria, resulting in accelerated capillary cell apoptosis. Regulation of MMP-9 is controlled by multiple transcription factors including nuclear factor-kB (NF-kB) and activator protein-1 (AP-1). Binding of these transcription factors, however, can
Qianghua Xia et al.
Diabetologia, 59(11), 2360-2368 (2016-08-20)
One of the most strongly associated type 2 diabetes loci reported to date resides within the TCF7L2 gene. Previous studies point to the T allele of rs7903146 in intron 3 as the causal variant at this locus. We aimed to

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service