Skip to Content
Merck

EHU063791

MISSION® esiRNA

targeting human LMNA

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ACCAAGAAGGAGGGTGACCTGATAGCTGCTCAGGCTCGGCTGAAGGACCTGGAGGCTCTGCTGAACTCCAAGGAGGCCGCACTGAGCACTGCTCTCAGTGAGAAGCGCACGCTGGAGGGCGAGCTGCATGATCTGCGGGGCCAGGTGGCCAAGCTTGAGGCAGCCCTAGGTGAGGCCAAGAAGCAACTTCAGGATGAGATGCTGCGGCGGGTGGATGCTGAGAACAGGCTGCAGACCATGAAGGAGGAACTGGACTTCCAGAAGAACATCTACAGTGAGGAGCTGCGTGAGACCAAGCGCCGTCATGAGACCCGACTGGTGGAGATTGACAATGGGAAGCAGCGTGAGTTTGAGAGCCGGCTGGCGGATGCGCTGCAGGAACTGCGGGCCCAGCATGAGGACCAGGTGGAGCAGTA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... LMNA(4000)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Paraskevi Sakellariou et al.
Skeletal muscle, 6, 4-4 (2016-03-01)
Studies of the pathogenic mechanisms underlying human myopathies and muscular dystrophies often require animal models, but models of some human diseases are not yet available. Methods to promote the engraftment and development of myogenic cells from individuals with such diseases
Qiao Zhang et al.
Molecular biology of the cell, 30(7), 899-906 (2018-12-20)
Cancer cell migration through narrow constrictions generates compressive stresses on the nucleus that deform it and cause rupture of nuclear membranes. Nuclear membrane rupture allows uncontrolled exchange between nuclear and cytoplasmic contents. Local tensile stresses can also cause nuclear deformations
Berta N Vazquez et al.
Nucleic acids research, 47(15), 7870-7885 (2019-06-22)
Long interspersed elements-1 (LINE-1, L1) are retrotransposons that hold the capacity of self-propagation in the genome with potential mutagenic outcomes. How somatic cells restrict L1 activity and how this process becomes dysfunctional during aging and in cancer cells is poorly