Skip to Content
Merck

EHU130211

MISSION® esiRNA

targeting human PRDM1

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCAGCTCTCCAATCTGAAGGTCCACCTGAGAGTGCACAGTGGAGAACGGCCTTTCAAATGTCAGACTTGCAACAAGGGCTTTACTCAGCTCGCCCACCTGCAGAAACACTACCTGGTACACACGGGAGAAAAGCCACATGAATGCCAGGTCTGCCACAAGAGATTTAGCAGCACCAGCAATCTCAAGACCCACCTGCGACTCCATTCTGGAGAGAAACCATACCAATGCAAGGTGTGCCCTGCCAAGTTCACCCAGTTTGTGCACCTGAAACTGCACAAGCGTCTGCACACCCGGGAGCGGCCCCACAAGTGCTCCCAGTGCCACAAGAACTACATCCATCTCTGTAGCCTCAAGGTTCACCTGAAAGGGAACTGCGCTGCGGCCCCGGCGCCTGGGCTGCCCTTGGAAGATCTGACCCGAATC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... PRDM1(639)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Liuluan Zhu et al.
Journal of hematology & oncology, 10(1), 124-124 (2017-06-21)
T cell immunoglobulin and immunoreceptor tyrosine-based inhibitory motif (ITIM) domain (TIGIT) and programmed cell death protein 1 (PD-1) are important inhibitory receptors that associate with T cell exhaustion in acute myeloid leukemia (AML). In this study, we aimed to determine
Gundappa Saha et al.
Frontiers in cellular and infection microbiology, 10, 594431-594431 (2020-11-17)
Precise regulation of inflammasome is critical during any pathogenic encounter. The whole innate immune system comprising of pattern recognition receptors (PRRs) relies on its ability to sense microbes. The fate of cellular death in infected cells depends mostly on the
Enzo Acerbi et al.
Scientific reports, 6, 23128-23128 (2016-03-16)
T helper 17 (TH17) cells represent a pivotal adaptive cell subset involved in multiple immune disorders in mammalian species. Deciphering the molecular interactions regulating TH17 cell differentiation is particularly critical for novel drug target discovery designed to control maladaptive inflammatory