Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GTTTGCAAAAGGGGGAAAGTAGTTTGCTGCCTCTTTAAGACTAGGACTGAGAGAAAGAAGAGGAGAGAGAAAGAAAGGGAGAGAAGTTTGAGCCCCAGGCTTAAGCCTTTCCAAAAAATAATAATAACAATCATCGGCGGCGGCAGGATCGGCCAGAGGAGGAGGGAAGCGCTTTTTTTGATCCTGATTCCAGTTTGCCTCTCTCTTTTTTTCCCCCAAATTATTCTTCGCCTGATTTTCCTCGCGGAGCCCTGCGCTCCCGACACCCCCGCCCGCCTCCCCTCCTCCTCTCCCCCCGCCCGCGGGCCCCCCAAAGTCCCGGCCGGGCCGAGGGTCGGCGGCCGCCGGCGGGCCGGGCCCGCGCACAGCGCCCGCATGTACAACATGATGGAGACGGAGCTGAA
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... SOX2(6657), Sox2()
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Liang Tang et al.
Pathology oncology research : POR, 24(4), 907-913 (2018-04-06)
Osteosarcoma (OS) was a prevalent malignant bone tumor which threatens people's health worldwide. Wnt/β catenin signaling pathway had been proved significant in various cancers, indicating its possible function in OS as well. Sox2, a crucial member among SOX family could
Jiaxuan Chen et al.
Molecular carcinogenesis, 56(10), 2267-2278 (2017-05-26)
Fas signaling promotes colorectal cancer (CRC) metastasis by inducing epithelial-mesenchymal transition (EMT). The acquisition of EMT properties in turn induces stemness but the mechanism by which Fas signaling contributes to it still remains unclear. Hence, the aim of this study
Nicolas Chassaing et al.
Genome research, 26(4), 474-485 (2016-02-20)
Ocular developmental anomalies (ODA) such as anophthalmia/microphthalmia (AM) or anterior segment dysgenesis (ASD) have an estimated combined prevalence of 3.7 in 10,000 births. Mutations in SOX2 are the most frequent contributors to severe ODA, yet account for a minority of