Skip to Content
Merck

EHU081481

MISSION® esiRNA

targeting human MITF

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TTGGGGTTTATTTCAGCAAACTTGTTGAATTTATTTTTAAGAAAGAAATACTGTATTGGGAAGTTACTGTTACTTGATAACAATGTTTTAACAAGAAGCAATGTTATAAAGTTAGTTTCAGTGCATTATCTACTTGTGTAGTCCTATGCAATAACAGTAGTGTTACATGTATCAAGCCTAGATGTTTTATACAGATGCCATATAGTGTTATGAGCCAGGCTGTTGAATGGAATTTCTCAGTAGCAGCCTACAACTGAATAGCAAGTGGCATAAAGCATATCCATTCAGAATGAAGTGCCTTAAATATAGCAGTAGTCTTTTTTGGACTAGCACTGACTGAACTGTAATGTAGGGGAAAGTTTCATGATGGTATCTATAGTCAAGACGAACATGTAGCATGGTGC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... MITF(4286)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Megha Rajasekhar et al.
Scientific reports, 8(1), 7264-7264 (2018-05-10)
Myelopoiesis involves differentiation of hematopoietic stem cells to cellular populations that are restricted in their self-renewal capacity, beginning with the common myeloid progenitor (CMP) and leading to mature cells including monocytes and granulocytes. This complex process is regulated by various
Hua Chen et al.
International journal of clinical and experimental pathology, 13(4), 730-737 (2020-05-02)
Coronary atherosclerosis affects human health all over the world. PON1 was found to be associated with coronary atherosclerosis but the specific mechanism is still unclear. Non-coding RNA plays an important role in many diseases. In recent years, studies have focused
Jing Wang et al.
Journal of cellular biochemistry, 119(11), 8862-8871 (2018-08-21)
Oral lichen planus (OLP) is a severe T cell-mediated disorder of the mucosa, which causes chronic inflammation. Forkhead box P3 (Foxp3) regulates the immune response and plays an important role in immunological diseases. The current study aimed to determine the