EMU000411
MISSION® esiRNA
targeting mouse Sirt1
Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
TAAGCGGCTTGAGGGTAATCAATACCTGTTTGTACCACCAAATCGTTACATATTCCACGGTGCTGAGGTATACTCAGACTCTGAAGATGACGTCTTGTCCTCTAGTTCCTGTGGCAGTAACAGTGACAGTGGCACATGCCAGAGTCCAAGTTTAGAAGAACCCTTGGAAGATGAAAGTGAAATTGAAGAATTCTACAATGGCTTGGAAGATGATACGGAGAGGCCCGAATGTGCTGGAGGATCTGGATTTGGAGCTGATGGAGGGGATCAAGAGGTTGTTAATGAAGCTATAGCTACAAGACAGGAATTGACAGATGTAAACTATCCATCAGACAAATCATAACACTATTGAAGCTGTCCGGATTCAGGAATTGCTCCACCAGCATTGGGAACTTTAGCA
Ensembl | mouse accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
mouse ... SIRT1(93759), Sirt1(93759)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Xiwen Xiong et al.
PloS one, 14(2), e0212523-e0212523 (2019-02-23)
Nicotinamide phosphoribosyltransferase (NAMPT) is a rate-limiting enzyme in mammalian nicotinamide adenine dinucleotide (NAD)+ biosynthesis. Through its NAD+-biosynthetic activity, NAMPT influences the activity of NAD+-dependent enzymes, such as sirtuins. NAMPT is able to modulate processes involved in the pathogenesis of non-alcohol
Mickaël Ohanna et al.
Oncotarget, 5(8), 2085-2095 (2014-04-20)
SIRT1 operates as both a tumor suppressor and oncogenic factor depending on the cell context. Whether SIRT1 plays a role in melanoma biology remained poorly elucidated. Here, we demonstrate that SIRT1 is a critical regulator of melanoma cell proliferation. SIRT1
Yi Fu et al.
Cell metabolism, 32(6), 1052-1062 (2020-11-14)
Lipid accumulation in podocytes is a major determinant of diabetic kidney disease (DKD) and identification of potential therapeutic targets by mediating podocyte lipid metabolism has clinical importance. This study was to elucidate the role of JAML (junctional adhesion molecule-like protein)