Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
AAGGGAGAGGCAGGAAAGACATAAAAGCACAGGAGGGAAGAGATGGCCGCAAGAGGGGCCACCTCTTAGGTCAGATGGAAGATCTCAGAGCCAAGTCCTTCTACTCACGAGTAGAAGGACCGTTGGCCAACAGCCCTTTCACTTACCATCCCTGCCTCCCCCGTCCTGTTCCCCTTTTGACTTCAGCTGCCTGAAACAGCCATGTCCAAGTTCTTCACCTCTATCCAAAGGACTTGATTTGCATGGTATTGGATAAATCATTTCAGTATCCTCTCCATCACATGCCTGGCCCTTGCTCCCTTCAGCGCTAGACCATCAAGTTGGCATAAAGAAAAAAAAATGGGTTTGGGCCCTCAGAACCCTGCCCTGCATCTTTGTACAGCATCTGTGCCATGGATTTTG
Ensembl | mouse accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
mouse ... EGR1(13653), Egr1(13653)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Ming Yang et al.
Breast cancer research and treatment, 158(2), 277-286 (2016-07-06)
Sulforaphene (SFE, 4-methylsufinyl-3-butenyl isothiocyanate) is a member of isothiocyanates, which is derived from radish seeds. It has shown that multiple isothiocyanates, such as sulforaphane, can effectively inhibit cancer cell proliferation in vitro and in vivo. However, it is still largely
Qiang Chen et al.
BMC molecular and cell biology, 21(1), 80-80 (2020-11-11)
Arecoline is an alkaloid natural product found in the areca nut that can induce oral submucous fibrosis and subsequent development of cancer. However, numerous studies have shown that arecoline may inhibit fibroblast proliferation and prevent collagen synthesis. High doses of
Yin-Hsun Feng et al.
BMC cancer, 19(1), 791-791 (2019-08-11)
Roles of cancer stem cells and early growth response gene 1 (Egr1) in carcinogenesis have been extensively studied in lung cancer. However, the role of Egr1 in the metastasis of lung cancer remains undetermined, especially in regard to stem cell-related