Skip to Content
Merck

EMU060821

MISSION® esiRNA

targeting mouse Egr1

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AAGGGAGAGGCAGGAAAGACATAAAAGCACAGGAGGGAAGAGATGGCCGCAAGAGGGGCCACCTCTTAGGTCAGATGGAAGATCTCAGAGCCAAGTCCTTCTACTCACGAGTAGAAGGACCGTTGGCCAACAGCCCTTTCACTTACCATCCCTGCCTCCCCCGTCCTGTTCCCCTTTTGACTTCAGCTGCCTGAAACAGCCATGTCCAAGTTCTTCACCTCTATCCAAAGGACTTGATTTGCATGGTATTGGATAAATCATTTCAGTATCCTCTCCATCACATGCCTGGCCCTTGCTCCCTTCAGCGCTAGACCATCAAGTTGGCATAAAGAAAAAAAAATGGGTTTGGGCCCTCAGAACCCTGCCCTGCATCTTTGTACAGCATCTGTGCCATGGATTTTG

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Ming Yang et al.
Breast cancer research and treatment, 158(2), 277-286 (2016-07-06)
Sulforaphene (SFE, 4-methylsufinyl-3-butenyl isothiocyanate) is a member of isothiocyanates, which is derived from radish seeds. It has shown that multiple isothiocyanates, such as sulforaphane, can effectively inhibit cancer cell proliferation in vitro and in vivo. However, it is still largely
Qiang Chen et al.
BMC molecular and cell biology, 21(1), 80-80 (2020-11-11)
Arecoline is an alkaloid natural product found in the areca nut that can induce oral submucous fibrosis and subsequent development of cancer. However, numerous studies have shown that arecoline may inhibit fibroblast proliferation and prevent collagen synthesis. High doses of
Yin-Hsun Feng et al.
BMC cancer, 19(1), 791-791 (2019-08-11)
Roles of cancer stem cells and early growth response gene 1 (Egr1) in carcinogenesis have been extensively studied in lung cancer. However, the role of Egr1 in the metastasis of lung cancer remains undetermined, especially in regard to stem cell-related