Skip to Content
Merck

EHU066371

MISSION® esiRNA

targeting human CARM1

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCATGGGCTACATGCTCTTCAACGAGCGCATGCTGGAGAGCTACCTCCACGCCAAGAAGTACCTGAAGCCCAGCGGAAACATGTTTCCTACCATTGGTGACGTCCACCTTGCACCCTTCACGGATGAACAGCTCTACATGGAGCAGTTCACCAAGGCCAACTTCTGGTACCAGCCATCTTTCCATGGAGTGGACCTGTCGGCCCTCCGAGGTGCCGCGGTGGATGAGTATTTCCGGCAGCCTGTGGTGGACACATTTGACATCCGGATCCTGATGGCCAAGTCTGTCAAGTACACGGTGAACTTCTTAGAAGCCAAAGAAGGAGATTTGCACAGGATAGAAATCCCATTCAAATTCCACATGCTGCATTCAGGGCTGGTCCACGGCCTGGCTTTCTGGTTTGACGTTGCTTTCA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... CARM1(10498)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Qiongjie Cao et al.
Eye and vision (London, England), 7, 35-35 (2020-08-09)
MicroRNAs (miRNAs) play critical roles in corneal development and functional homeostasis. Our previous study identified miR-184 as one of the most highly expressed miRNAs in the corneal epithelium. Even though its expression level plummeted dramatically during corneal epithelial wound healing
Deqin Wu et al.
Aging, 12(11), 10578-10593 (2020-06-04)
The underlying molecular mechanisms of tumorigenesis and progression of non-small cell lung cancer (NSCLC) are not yet fully elucidated. In the present study, invitro functional dissections suggest that siRNA-mediated silencing of CCNE2 profoundly attenuated the proliferative and colony-formative abilities of
Cynthia M Quintero et al.
Journal of molecular biology, 430(21), 4168-4182 (2018-08-29)
Activation of the retinoic acid (RA) signaling pathway is important for controlling embryonic stem cell differentiation and development. Modulation of this pathway occurs through the recruitment of different epigenetic regulators at the retinoic acid receptors (RARs) located at RA-responsive elements