Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CCATGGGCTACATGCTCTTCAACGAGCGCATGCTGGAGAGCTACCTCCACGCCAAGAAGTACCTGAAGCCCAGCGGAAACATGTTTCCTACCATTGGTGACGTCCACCTTGCACCCTTCACGGATGAACAGCTCTACATGGAGCAGTTCACCAAGGCCAACTTCTGGTACCAGCCATCTTTCCATGGAGTGGACCTGTCGGCCCTCCGAGGTGCCGCGGTGGATGAGTATTTCCGGCAGCCTGTGGTGGACACATTTGACATCCGGATCCTGATGGCCAAGTCTGTCAAGTACACGGTGAACTTCTTAGAAGCCAAAGAAGGAGATTTGCACAGGATAGAAATCCCATTCAAATTCCACATGCTGCATTCAGGGCTGGTCCACGGCCTGGCTTTCTGGTTTGACGTTGCTTTCA
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... CARM1(10498)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Qiongjie Cao et al.
Eye and vision (London, England), 7, 35-35 (2020-08-09)
MicroRNAs (miRNAs) play critical roles in corneal development and functional homeostasis. Our previous study identified miR-184 as one of the most highly expressed miRNAs in the corneal epithelium. Even though its expression level plummeted dramatically during corneal epithelial wound healing
Deqin Wu et al.
Aging, 12(11), 10578-10593 (2020-06-04)
The underlying molecular mechanisms of tumorigenesis and progression of non-small cell lung cancer (NSCLC) are not yet fully elucidated. In the present study, invitro functional dissections suggest that siRNA-mediated silencing of CCNE2 profoundly attenuated the proliferative and colony-formative abilities of
Cynthia M Quintero et al.
Journal of molecular biology, 430(21), 4168-4182 (2018-08-29)
Activation of the retinoic acid (RA) signaling pathway is important for controlling embryonic stem cell differentiation and development. Modulation of this pathway occurs through the recruitment of different epigenetic regulators at the retinoic acid receptors (RARs) located at RA-responsive elements