Skip to Content
Merck

EHU025411

MISSION® esiRNA

targeting human CDH13

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AAGGGAAACGACAAGCTACGCTATGAGGTCTCGAGCCCATACTTCAAGGTGAACAGCGATGGCGGCTTAGTTGCTCTGAGAAACATAACTGCAGTGGGCAAAACTCTGTTCGTCCATGCACGGACCCCCCATGCGGAAGATATGGCAGAACTCGTGATTGTCGGGGGGAAAGACATCCAGGGCTCCTTGCAGGATATATTTAAATTTGCAAGAACTTCTCCTGTCCCAAGACAAAAGAGGTCCATTGTGGTATCTCCCATTTTAATTCCAGAGAATCAGAGACAGCCTTTCCCAAGAGATGTTGGCAAGGTAGTCGATAGTGACAGGCCAGAAAGGTCCAAGTTCCGGCTCACTGGAAAGGGAGTGGATCAAGAGCCTAAAGGAATTTTCAGAATCAATGAGAACACAGGGAGCGTCTC

Ensembl | human accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... CDH13(1012)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Yuya Fujishima et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 31(4), 1571-1583 (2017-01-08)
Adiponectin, an adipocyte-derived protein abundant in the circulation, is thought to be protective against atherosclerosis. However, it is not fully understood how the association of adiponectin with vascular cells and its antiatherogenic effect are connected. In this study, T-cadherin was
Yuri Tsugawa-Shimizu et al.
American journal of physiology. Endocrinology and metabolism, 320(2), E179-E190 (2020-12-08)
Adiponectin (APN) is a circulating protein specifically produced by adipocytes. Native APN specifically binds to T-cadherin, a glycosylphosphatidylinositol-anchored protein, mediating the exosome-stimulating effects of APN in endothelial, muscle, and mesenchymal stem cells. It was previously reported that APN has beneficial
Keisuke Matsuda et al.
Endocrinology, 156(3), 934-946 (2014-12-17)
Adiponectin (Adipo), a multimeric adipocyte-secreted protein abundant in the circulation, is implicated in cardiovascular protective functions. Recent work documented that Adipo locally associates with responsive tissues through interactions with T-cadherin (Tcad), an atypical, glycosylphosphatidylinositol (GPI)-anchored cadherin cell surface glycoprotein. Mice