Skip to Content
Merck

EHU093581

MISSION® esiRNA

targeting human CTNND1

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GTGGCTGAAGTTGAACATGGGAGCTTATTGCTAATTTAGAGATAGGAAACTGAAGCATAAAGAATTAATGACTTACTTTAATTACTGGAATTCTTCTGCAACATTTGACAAAACTAACCTTGAATAAGGCCCACTGTAATACGTAGCTCTCTTAAATATAACACTTAGGACTAGAAGATTAGAAACTACCAATCCCAACTACGTAATAGGAAAATGTAGGATCAAAAGGCCCATGTATATAAGTACTGACCACTGGGCCATAATGTTGCTTCTCAGGCTATATGCAGTCCTTTAGTCAGAAGTCAATAGGCCTATTTATTAATATTTTACAGACCATATTACCTGGATTACCAGGGACTATCTTTGCTGC

Ensembl | human accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... CTNND1(1500)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Xiao-Hui Gao et al.
Scientific reports, 10(1), 44-44 (2020-01-09)
Low miR-96-5p expression is characteristic of many cancers but its role in breast cancer (BCa) remains poorly defined. Here, the role of miR-96-5p in BC development was assessed. We demonstrate that exogenously expressing miR-96-5p inhibits the proliferative, migratory and invasive
Ningjia Cao et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 106, 483-490 (2018-07-11)
MicroRNAs (miRNAs) are solid factors involved in the initiation and progression of hepatocellular carcinoma (HCC). Recently, miR-298 is recognized as a cancer-associated miRNA in breast, gastric and ovarian cancer. However, the functional role of miR-298 and its underlying mechanism are
Alisha M Mendonsa et al.
PloS one, 15(6), e0235337-e0235337 (2020-06-27)
p120-catenin is considered to be a tumor suppressor because it stabilizes E-cadherin levels at the cell surface. p120-catenin phosphorylation is increased in several types of cancer, but the role of phosphorylation in cancer is unknown. The phosphorylation state of p120-catenin