Skip to Content
Merck

EHU131051

MISSION® esiRNA

targeting human DDX58

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ATCTGGAGGAACTGGAGCAAGTTGTTTATAAGCCCCAGAAGTTTTTCAGGAAAGTGGAATCACGGATTAGCGACAAATTTAAATACATCATAGCTCAGCTGATGAGGGACACAGAGAGTCTGGCAAAGAGAATCTGCAAAGACCTCGAAAACTTATCTCAAATTCAAAATAGGGAATTTGGAACACAGAAATATGAACAATGGATTGTTACAGTTCAGAAAGCATGCATGGTGTTCCAGATGCCAGACAAAGATGAAGAGAGCAGGATTTGTAAAGCCCTGTTTTTATACACTTCACATTTGCGGAAATATAATGATGCCCTCATTATCAGTGAGCATGCACGAATGAAAGATGCTCTGGATTACTTGAAAGACTTCTTCAGCAATGTCCGAGCAGCAGGATTCGATGAGATTGAGCAAGATCTTACTCAGAGATTTGAAGAAAAGCTGCAGGAACTAGAAAGTGTTTCCAGGGATCCC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Gene Information

human ... DDX58(23586)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Ting He et al.
Life sciences, 231, 116570-116570 (2019-06-18)
Systemic inflammation is a main hallmark of chronic kidney disease (CKD), but the underlying mechanisms of pathogenesis of CKD-associated systemic inflammation is unclear. Current study was designed to investigate the relationship between indoxyl sulphate (IS) and CKD-associated systemic inflammation along
Ming Zhong et al.
BMC cancer, 19(1), 439-439 (2019-05-16)
Dendritic cells (DCs) alter their role from being immunostimulatory to immunosuppressive at advanced stages of tumor progression, but the influence of cancer stem cells (CSCs) and their secreted factors on generation and phenotypic change of DCs is unknown. Retinoic acid-inducible
Luciano Castiello et al.
Cancer immunology, immunotherapy : CII, 68(9), 1479-1492 (2019-08-30)
RIG-I is a cytosolic RNA sensor that recognizes short 5' triphosphate RNA, commonly generated during virus infection. Upon activation, RIG-I initiates antiviral immunity, and in some circumstances, induces cell death. Because of this dual capacity, RIG-I has emerged as a
Darong Yang et al.
PloS one, 9(4), e94501-e94501 (2014-04-15)
The interaction between hepatitis C virus (HCV) and human hepatic innate antiviral responses is unclear. The aim of this study was to examine how human hepatocytes respond to HCV infection. An infectious HCV isolate, JFH1, was used to infect a
Lei Li et al.
Neuroscience letters, 672, 46-52 (2018-02-24)
The retinoic acid-inducible gene I (RIG-I) is a crucial cytoplasmic pathogen recognition receptor involved in neuroinflammation in degenerative diseases. In the present study, in vitro human astrocytes were subjected to a chemical hypoxia model using cobalt chloride pretreatment. Chemical hypoxia

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service