Skip to Content
Merck

EHU147511

MISSION® esiRNA

targeting human TRAF6

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCCCAGGCTGTTCATAGTTTGAGCGTTATACCCGACTCTGGGTATATCTCAGAGGTCCGGAATTTCCAGGAAACTATTCACCAGTTAGAGGGTCGCCTTGTAAGACAAGACCATCAAATCCGGGAGCTGACTGCTAAAATGGAAACTCAGAGTATGTATGTAAGTGAGCTCAAACGAACCATTCGAACCCTTGAGGACAAAGTTGCTGAAATCGAAGCACAGCAGTGCAATGGAATTTATATTTGGAAGATTGGCAACTTTGGAATGCATTTGAAATGTCAAGAAGAGGAGAAACCTGTTGTGATTCATAGCCCTGGATTCTACACTGGCAAACCCGGGTACAAACTGTGCATGCGCTTGCACCTTCAGTTACCGACTGCTCAGCGCTGTGCAAACTATATATCCCTTTTTGTCCACACAATGCAAGGAGAA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... TRAF6(7189)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Yancan Liang et al.
Journal of oral pathology & medicine : official publication of the International Association of Oral Pathologists and the American Academy of Oral Pathology, 47(6), 583-589 (2018-03-27)
Tumor necrosis factor (TNF) receptor-associated factor 6 (TRAF6) has been proved to play an important role in tumorigenesis, invasion, and metastasis. However, its precise role salivary adenoid cystic carcinoma (SACC) has not been determined. The aim of this study was
Zhiyong He et al.
Oncology reports, 35(4), 1933-1940 (2016-02-06)
Tumor necrosis factor receptor-associated factor 6 (TRAF6) has been found to be involved in multiple cancers. However, the effect of small interfering RNA (siRNA)‑induced knockdown of TRAF6 on the biological behaviors of cancer cells remains unknown. Thus, the present study
Quanfeng Wu et al.
Cancer cell international, 17, 62-62 (2017-06-09)
To study the mechanism by which epithelial ovarian cancer (EOC)-derived exosomes restore the migration of endothelial cells that is suppressed by TAM-derived exosomes. Exosomes were isolated from TAMs in the ascites of patients with EOC. The effect of exosomes on