Skip to Content
Merck

EMU007401

MISSION® esiRNA

targeting mouse Atg4b

Sign In to View Organizational & Contract Pricing.

Select a Size


About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GACGCAGCCACTTTGACATATGATACTCTCCGGTTTGCTGAATTTGAAGATTTCCCTGAGACCTCAGAGCCTGTTTGGATTCTGGGCAGAAAATACAGCATTTTCACAGAGAAGGACGAAATCTTGTCTGATGTTGCATCCAGACTTTGGTTTACATACAGGAGAAACTTTCCAGCTATTGGGGGAACTGGCCCTACTTCAGACACAGGCTGGGGTTGCATGCTTCGGTGTGGACAGATGATCTTTGCCCAGGCCCTGGTATGCCGGCACTTAGGTCGAGATTGGAGGTGGACTCAGCGGAAGAGGCAGCCTGACAGCTACTTTAATGTCCTCAATGCTTTCCTCGACAGGAAGGACAGCTACTATTCCATCCATCAGATAGCGCAAATGGGAGTTGGCGAAGGCAAGTCTA

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Quality Level

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Katharina Rothe et al.
Blood, 123(23), 3622-3634 (2014-04-24)
Previous studies demonstrated that imatinib mesylate (IM) induces autophagy in chronic myeloid leukemia (CML) and that this process is critical to cell survival upon therapy. However, it is not known if the autophagic process differs at basal levels between CML
Pei-Feng Liu et al.
Autophagy, 10(8), 1454-1465 (2014-07-06)
Autophagy is reported to suppress tumor proliferation, whereas deficiency of autophagy is associated with tumorigenesis. ATG4B is a deubiquitin-like protease that plays dual roles in the core machinery of autophagy; however, little is known about the role of ATG4B on

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service