Skip to Content
Merck

EHU110531

MISSION® esiRNA

targeting human PPIB

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ATGTAGGCCGGGTGATCTTTGGTCTCTTCGGAAAGACTGTTCCAAAAACAGTGGATAATTTTGTGGCCTTAGCTACAGGAGAGAAAGGATTTGGCTACAAAAACAGCAAATTCCATCGTGTAATCAAGGACTTCATGATCCAGGGCGGAGACTTCACCAGGGGAGATGGCACAGGAGGAAAGAGCATCTACGGTGAGCGCTTCCCCGATGAGAACTTCAAACTGAAGCACTACGGGCCTGGCTGGGTGAGCATGGCCAACGCAGGCAAAGACACCAACGGCTCCCAGTTCTTCATCACGACAGTCAAGACAGCCTGGCTAGATGGCAAGCATGTGGTGTTTGGCAAAGTTCTAGAGGGCATGGAGGTGGTGCGGAAGGTGGAGAGCACCAAGACAGACAGCCGGGATAAACCCCTGAAGGATGTGATCATCGCAGACTGCGGCAAGATCGAGGTGGAGAAG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... PPIB(5479)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Li Liu et al.
Retrovirology, 8, 94-94 (2011-11-16)
Upon cellular entry retroviruses must avoid innate restriction factors produced by the host cell. For human immunodeficiency virus (HIV) human restriction factors, APOBEC3 (apolipoprotein-B-mRNA-editing-enzyme), p21 and tetherin are well characterised. To identify intrinsic resistance factors to HIV-1 replication we screened
Paulo C M Urbano et al.
Frontiers in immunology, 10, 3047-3047 (2020-02-11)
Maintenance of regulatory T cells CD4+CD25highFOXP3+ (Treg) stability is vital for proper Treg function and controlling the immune equilibrium. Treg cells are heterogeneous and can reveal plasticity, exemplified by their potential to express IL-17A. TNFα-TNFR2 signaling controls IL-17A expression in
J E Hanning et al.
British journal of cancer, 108(2), 450-460 (2013-01-10)
When designing therapeutic short-interfering RNAs (siRNAs), off-target effects (OTEs) are usually predicted by computational quantification of messenger RNAs (mRNAs) that contain matches to the siRNA seed sequence in their 3' UTRs. It is assumed that the higher the number of