Skip to Content
Merck

EHU113621

MISSION® esiRNA

targeting human MEF2C

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGGGTTGATGAAGAAGGCTTATGAGCTGAGCGTGCTGTGTGACTGTGAGATTGCGCTGATCATCTTCAACAGCACCAACAAGCTGTTCCAGTATGCCAGCACCGACATGGACAAAGTGCTTCTCAAGTACACGGAGTACAACGAGCCGCATGAGAGCCGGACAAACTCAGACATCGTGGAGACGTTGAGAAAGAAGGGCCTTAATGGCTGTGACAGCCCAGACCCCGATGCGGACGATTCCGTAGGTCACAGCCCTGAGTCTGAGGACAAGTACAGGAAAATTAACGAAGATATTGATCTAATGATCAGCAGGCAAAGATTGTGTGCTGTTCCACCTCCCAACTTCGAGATGCCAGTCTCCATCCCAGTGTCCAGCCACAACAGTTTGGTGTACAGCAACCCTGTCAGCTCACT

Ensembl | human accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... MEF2C(4208)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Hong-Ping Chen et al.
Journal of cellular physiology, 234(12), 23315-23325 (2019-05-30)
MicroRNAs (miRNAs) is a small molecule (19-25 nucleotide) noncoding RNA that inhibits the expression of target messenger RNA (mRNA) at the posttranscriptional level as an endogenous regulator. There is an increasing evidence that miR-199a-3p has a significant effect on the
Aleksandra Deczkowska et al.
Nature communications, 8(1), 717-717 (2017-09-30)
During ageing, microglia acquire a phenotype that may negatively affect brain function. Here we show that ageing microglial phenotype is largely imposed by interferon type I (IFN-I) chronically present in aged brain milieu. Overexpression of IFN-β in the CNS of
Mingliang Bai et al.
EMBO reports, 21(11), e50283-e50283 (2020-10-06)
A microdeletion within human chromosome 5q14.3 has been associated with the occurrence of neurodevelopmental disorders, such as autism and intellectual disability, and MEF2C haploinsufficiency was identified as main cause. Here, we report that a brain-enriched long non-coding RNA, NDIME, is located