Skip to Content
Merck

EHU025841

MISSION® esiRNA

targeting human HDAC1

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CGAATCCGCATGACTCATAATTTGCTGCTCAACTATGGTCTCTACCGAAAAATGGAAATCTATCGCCCTCACAAAGCCAATGCTGAGGAGATGACCAAGTACCACAGCGATGACTACATTAAATTCTTGCGCTCCATCCGTCCAGATAACATGTCGGAGTACAGCAAGCAGATGCAGAGATTCAACGTTGGTGAGGACTGTCCAGTATTCGATGGCCTGTTTGAGTTCTGTCAGTTGTCTACTGGTGGTTCTGTGGCAAGTGCTGTGAAACTTAATAAGCAGCAGACGGACATCGCTGTGAATTGGGCTGGGGGCCTGCACCATGCAAAGAAGTCCGAGGCATCTGGCTTCTGTTACGTCAATGATATCGTCTTGGCCATCCTGGAACTGCTAAAGTATCACCAGAGGGTGCTGTACA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... HDAC1(3065)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Soniya Bastola et al.
Nature communications, 11(1), 4660-4660 (2020-09-18)
Intratumor spatial heterogeneity facilitates therapeutic resistance in glioblastoma (GBM). Nonetheless, understanding of GBM heterogeneity is largely limited to the surgically resectable tumor core lesion while the seeds for recurrence reside in the unresectable tumor edge. In this study, stratification of
Chaojie Hu et al.
Journal of leukocyte biology, 101(3), 633-642 (2016-06-05)
Binge drinking represses host innate immunity and leads to a high risk of infection. Acute EtOH-pretreated macrophages exhibit a decreased production of proinflammatory mediators in response to LPS. ATF3 is induced and counter-regulates the LPS/TLR4 inflammatory cascade. Here, we investigated
Jing Yang et al.
Scientific reports, 7, 43864-43864 (2017-03-07)
Hepatocellular carcinoma (HCC) is one of the most commonly diagnosed cancers in the world. Elevated glucose metabolism in the availability of oxygen, a phenomenon called the Warburg effect, is important for cancer cell growth. Fructose-1,6-bisphosphatase (FBP1) is a rate-limiting enzyme