Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
CGAATCCGCATGACTCATAATTTGCTGCTCAACTATGGTCTCTACCGAAAAATGGAAATCTATCGCCCTCACAAAGCCAATGCTGAGGAGATGACCAAGTACCACAGCGATGACTACATTAAATTCTTGCGCTCCATCCGTCCAGATAACATGTCGGAGTACAGCAAGCAGATGCAGAGATTCAACGTTGGTGAGGACTGTCCAGTATTCGATGGCCTGTTTGAGTTCTGTCAGTTGTCTACTGGTGGTTCTGTGGCAAGTGCTGTGAAACTTAATAAGCAGCAGACGGACATCGCTGTGAATTGGGCTGGGGGCCTGCACCATGCAAAGAAGTCCGAGGCATCTGGCTTCTGTTACGTCAATGATATCGTCTTGGCCATCCTGGAACTGCTAAAGTATCACCAGAGGGTGCTGTACA
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... HDAC1(3065)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Soniya Bastola et al.
Nature communications, 11(1), 4660-4660 (2020-09-18)
Intratumor spatial heterogeneity facilitates therapeutic resistance in glioblastoma (GBM). Nonetheless, understanding of GBM heterogeneity is largely limited to the surgically resectable tumor core lesion while the seeds for recurrence reside in the unresectable tumor edge. In this study, stratification of
Chaojie Hu et al.
Journal of leukocyte biology, 101(3), 633-642 (2016-06-05)
Binge drinking represses host innate immunity and leads to a high risk of infection. Acute EtOH-pretreated macrophages exhibit a decreased production of proinflammatory mediators in response to LPS. ATF3 is induced and counter-regulates the LPS/TLR4 inflammatory cascade. Here, we investigated
Jing Yang et al.
Scientific reports, 7, 43864-43864 (2017-03-07)
Hepatocellular carcinoma (HCC) is one of the most commonly diagnosed cancers in the world. Elevated glucose metabolism in the availability of oxygen, a phenomenon called the Warburg effect, is important for cancer cell growth. Fructose-1,6-bisphosphatase (FBP1) is a rate-limiting enzyme