Skip to Content
Merck

EHU058791

MISSION® esiRNA

targeting human PPARD

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AAGGCCTTCTCCAAGCACATCTACAATGCCTACCTGAAAAACTTCAACATGACCAAAAAGAAGGCCCGCAGCATCCTCACCGGCAAAGCCAGCCACACGGCGCCCTTTGTGATCCACGACATCGAGACATTGTGGCAGGCAGAGAAGGGGCTGGTGTGGAAGCAGTTGGTGAATGGCCTGCCTCCCTACAAGGAGATCAGCGTGCACGTCTTCTACCGCTGCCAGTGCACCACAGTGGAGACCGTGCGGGAGCTCACTGAGTTCGCCAAGAGCATCCCCAGCTTCAGCAGCCTCTTCCTCAACGACCAGGTTACCCTTCTCAAGTATGGCGTGCACGAGGCCATCTTCGCCATGCTGGCCTCTATCGTCAACAAGGACGGGCTGCTGGTAGCCAACGGCAGTGGCTTTGTCACCCGTGAGTTCCTGCGCAGCCTCCGCAAACCCTTCAGTGATATCATTGAGCCTAAGTTTGAATTTGCTGTCAAGTTCAACGC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... PPARD(5467)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Mark Wei Yi Tan et al.
Cell death and differentiation, 27(9), 2668-2680 (2020-04-22)
The incidence of nonmelanoma skin cancer (NMSC) has been increasing worldwide. Most studies have highlighted the importance of cancer-associated fibroblasts (CAFs) in NMSC progression. However much less is known about the communication between normal fibroblasts and epithelia; disruption of this
H B Shi et al.
Journal of dairy science, 100(1), 797-806 (2016-11-21)
In rodents, peroxisome proliferator-activated receptor delta (PPARD) is associated primarily with catabolism of fatty acids. However, the role of PPARD in regulating lipid metabolism in ruminant mammary gland remains unknown. In the present study, we assessed the mRNA abundance of
Yi Liu et al.
Cancer research, 79(5), 954-969 (2019-01-27)
APC mutations activate aberrant β-catenin signaling to drive initiation of colorectal cancer; however, colorectal cancer progression requires additional molecular mechanisms. PPAR-delta (PPARD), a downstream target of β-catenin, is upregulated in colorectal cancer. However, promotion of intestinal tumorigenesis following deletion of