Skip to Content
Merck

EHU072661

MISSION® esiRNA

targeting human MLKL

Sign In to View Organizational & Contract Pricing.

Select a Size

Change View

About This Item

NACRES:
NA.51
UNSPSC Code:
41105324
Technical Service
Need help? Our team of experienced scientists is here for you.
Let Us Assist


description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGGACACATCCCACTCCAAATGATATTTCCAAAAACATACCTCTGACAGTAACTTTGATAGATGGTTTGTCAAATGTATCTTTCTGGGTATCCACACCTCTTGGCAATGAAATTTGCAGCTCCTCCCTTCCATAAATGAAGTCTCTTTCCCCACCATTTGAATCTGGGCTGGCACTGTGACTTGATTTGATCAATAGAATGTGGAAGAAGTGACTGTATGCCAGTTCCAAGCCTAGGTTTCAAGAGGCCTTATAAATGTCTGTTGGAACCTTACCCAGCCATGAACATGTTGAGTGAGCATGCTGGAGAATGAGAGACCACATGAAGCAGAAACATGCTTTCCTAGCTGAAGTCATACTAGCCCAACCAACATGGCAGCTAACACATGAATGAGGCCAATCAAGACCAG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... MLKL(197259)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany


Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable



Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library



Piotr T Filipczak et al.
Cancer research, 76(24), 7130-7139 (2016-10-21)
Tuberous sclerosis complex (TSC) is a genetic multiorgan disorder characterized by the development of neoplastic lesions in kidney, lung, brain, heart, and skin. It is caused by an inactivating mutation in tumor suppressor genes coding the TSC1/TSC2 complex, resulting in
Chengkui Yang et al.
Cell death & disease, 8(10), e3084-e3084 (2017-10-06)
Receptor-interacting kinase-3 (RIP3) is a key regulator of necroptosis. It has been shown that the expression of RIP3 is silenced in most cancer cells and tissues due to genomic methylation. However, the regulatory mechanisms controlling RIP3 expression in cancer cells
Yu Xiong et al.
Cell death and differentiation, 26(10), 1929-1941 (2019-01-16)
Necroptosis is a programmed form of necrotic cell death, which is tightly regulated by the necroptotic signaling pathway containing receptor-interacting protein (RIP)1, RIP3, and mixed-lineage kinase domain-like (MLKL) protein. In addition to the RIP1-RIP3-MLKL axis, other factors regulating necroptosis are