Sign In to View Organizational & Contract Pricing.
Select a Size
Change View
About This Item
NACRES:
NA.51
UNSPSC Code:
41105324
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
TGAAATGCCTGGCTCCTATTCGAGACCCCAAGACCGAGCAGGATGGACATGATATTGAGAACGAGTGTCTAGGGATGGCTGTCCTGGCCATCTCACACTATGCCATGATGAAGAAGATGCAGTTGCCAGAACTGCCCAAGGACATCAGCTACAAGCGATATATTCCAGAAACATTGAATAAGTCCATCAGACAGAGGAACCTTCTCACCAGGATGCGGATAAATAATGTTTTCAAGGATTTCCTAAAGGAATTTAACAACAAGACCATTTGTGACAGCAGCGTGTCCACGCATGACCTGAAGGTGAAATACTTGGCTACCTTGGAAACTTTGACAAAACATTACGGTGCTGAAATATTTGAGACTTCCATGTTACTGATTTCATCAGAAAATGAGATGAATTGGTTTCATTCGAATGACGGTGGAAACGTTCTC
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... JAK1(3716)
General description
MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Matija Hedl et al.
Journal of immunology (Baltimore, Md. : 1950), 197(9), 3695-3704 (2016-09-25)
JAK2 genetic variants are associated with inflammatory bowel disease (IBD) and JAK inhibitors are being evaluated for therapy targeting immune-mediated diseases, including IBD. As JAK pathway-mediated cytokine regulation varies across cell types and stimulation conditions, we examined how JAK signaling
Han Liu et al.
Oncotarget, 8(24), 38113-38135 (2017-05-13)
Human colon cancers express higher levels of NADPH oxidase 1 [NOX1] than adjacent normal epithelium. It has been suggested that reactive oxygen species [ROS] derived from NOX1 contribute to DNA damage and neoplastic transformation in the colon, particularly during chronic
Elisabeth Losdyck et al.
The Journal of biological chemistry, 290(48), 29022-29034 (2015-10-09)
JAK1 and JAK3 are recurrently mutated in acute lymphoblastic leukemia. These tyrosine kinases associate with heterodimeric cytokine receptors such as IL-7 receptor or IL-9 receptor, in which JAK1 is appended to the specific chain, and JAK3 is appended to the